qRT-PCR for Expression Analysis of Zma-miR397a and Zma-LAC Under Abiotic Stress

Abstract

Abiotic stresses are the environmental conditions that reduce growth, development and productivity in Z. mays.  miR397a is a conserved miRNA which has potential functions in alleviating various abiotic stresses.  Plant Laccase belong to the blue copper oxidase family and are involved in lignification.  However, their physiological functions in plants are still not well understood. Little is known about the regulatory function of miR397a and Laccase in plant resistance to abiotic stresses. In a co-stress maize miRNA library constructed in our laboratory, these two genes showed antagonistic expression.  In this research we used qRT-PCR for expression analysis of Zma-miR397a and Zma-LAC under abiotic stress. The results showed that Zma-miR397a and Zma-LAC were differentially expressed under drought, salt, alkali, low temperature, Abscisic acid (ABA), Salicylic acid and K+ deficiency treatments in shoots and roots of maize seedlings.  Differential expression pattern of zma-miR397a and Zma-LAC was also recorded in different maize plant tissues.  A 143bp pre-miR397a fragment flanked by 226bp upstream and 288bp downstream was amplified by PCR.  The resultant sequence was analyzed by BlastN and showed 100% complementarity with the B73 pre-miR397a sequence from miRBase.  The conserved region of Zma-LAC was amplified and sequenced.  3’ and 5’ RACE PCR were used to amplify the 3’ end and 5’ end respectively.  The 1749bp Open Reading Frame (ORF) was amplified and sequenced.  Amino acid sequence analysis confirmed that it is a Laccase due to its features.  Zma-LAC was incorporated into the tobacco genome via Agrobacterium-mediated transformation.  Transgenic plants were screened using PCR and semi-quantitative PCR.  After salt stress and ABA treatment, transgenic tobacco plants showed root development as compared to wild-type plants.  This study suggests that Laccase-mediated salt stress tolerance might be a common mechanism used by plants during growth under salinity stress.

Keywords: Z. mays, Zma-miR397a, Zma-LAC, qRT-PCR, tobacco, stress tolerance

Contents Page

Abstract……………………………………………………

Summary…………………………………………………..

1 Background………………………………………………..

1.1Effect of Salt stress on plants………………………………….

1.2 miRNA Literature Review…………………………………..

1.2.1 Plant microRNA Research Trend…………………………..

1.2.2 miR397 Family……………………………………..

1.2.3 miR397 involvement in plant growth and development………………

1.2.4 miR397 involvement in abiotic stress response…………………..

1.3 miR397a target gene(Laccase) Literature Review……………………..

1.3.1 Laccase gene research progress……………………………

1.3.2 miR397a-mediated regulation of Laccase ……………………..

1.4 Theoretical significance and application…………………………..

1.5 Aim and Objectives……………………………………….

2 miR397a and  Laccase gene expression pattern analysis in maize…………………

2.1 Experimental materials …………………………………….

2.1.1 Plant materials and Abiotic stress treatments…………………….

2.1.2 Laboratory Reagents ………………………………….

2.1.3 Laboratory Equipment…………………………………

2.2 Methodology…………………………………………..

2.2.1 RNA extraction……………………………………..

2.2.2 qRT-PCR Primer design………………………………..

2.2.3 Total RNA extraction from Z. mays and first strand cDNA synthesis………

2.2.4 qRT-PCR…………………………………………

2.3 Results and analysis……………………………………….

2.4 Discussion…………………………………………….

2.5 Summary…………………………………………….

3. Cloning and characterization of pre-miR397a……………………………

3.1 Materials and methods……………………………………..

3.1.1 Plant material………………………………………

3.1.2 Laboratory Reagents…………………………………..

3.1.3 Laboratory Equipment…………………………………

3.2. Methodology…………………………………………..

3.2.1 Genomic DNA extraction……………………………….

3.2.2 Zma-pre-miR397a cloning……………………………….

3.2.3 Maize expression vector construction……………………………………………….

3.3. Results and analysis………………………………………

3.3.1 Cloning of pre-miR397a………………………………..

3.3.2 Zma-pre-miR397a sequence analysis…………………………

3.3.3 Plant expression vector construction…………………………

3.3.4 Transformation of A. tumefaciens with recombinant plasmid DNA……….

3.4 Discussion…………………………………………….

3.5 Summary…………………………………………….

4. Cloning and Bioinformatic analysis of Laccase…………………………..

4.1 Materials and methods……………………………………..

4.1.1 Plant materials………………………………………

4.1.2 Laboratory reagents…………………………………..

4.1.3 Laboratory instruments and equipment……………………….

4.2 Methodology…………………………………………..

4.2.1 Total maize RNA extraction………………………………

4.2.2 Cloning of the Laccase conserved region………………………………………..

4.2.3 Cloning of the Laccase gene 3’ end with 3’ RACE PCR……………..

4.2.4 Cloning of the Laccase gene 5’ end with 5’ RACE PCR……………..

4.2.5 Zma-LAC gene ORF cloning……………………………..

4.2.6 Laccase gene sequence Bioinformatic analysis…………………..

4.3 Results and analysis……………………………………….

4.3.1 Cloning of Laccase gene conserved region……………………..

4.3.2 Laccase gene 3’ end cloning………………………………

4.3.3 Laccase gene 5’ end cloning………………………………

4.3.4 Z. mays Laccase coding region determination……………………

4.3.5 Bioinformatic analysis of Laccase…………………………..

4.3.6 Plant expression vector construction…………………………

4.5 Summary……………………………………………..

5. Molecular and physiological screening of the transgenic tobacco plants…………….

5.1  Materials and methodology…………………………………..

5.1.1 Plant materials………………………………………

5.1.2 Laboratory reagents…………………………………..

5.1.3 Laboratory equipment………………………………….

5.2 Methodology…………………………………………..

5.2.1 Tobacco transformation…………………………………

5.2.2 Transgenic Tobacco plants molecular screening…………………..

5.2.3 Transgenic Tobacco plants physiological analysis…………………

5.3 Results and analysis………………………………………

5.3.1 Tobacco transformation…………………………………

5.3.2 Molecular screening of transgenic plants………………………

5.3.3 Physiological analysis tobacco transgenic plants………………….

5.4 Discussion…………………………………………….

5.5Summary………………………………………………………………………………… 69

Conclusion………………………………………………….

Future Pesperctive……………………………………………..

APPENDIX A……………………………………………….

APPENDIX B DNA Markers………………………………………

Acknowledgements…………………………………………….

Summary

Maize is an important cereal crop around the world.  It is susceptible to abiotic stress hence this research is aimed at characterizing two genes which might be of help in stress resistance and increase in yield.  The research will involve the use of qRT-PCR to observe the expression patterns of miR397a and Laccase in maize subjected to different abiotic stresses, phyto-hormones and nutrient deficiency and different tissues during growth.  The complete sequence for Laccase will be cloned using PCR (conserved region), 3’RACE PCR (3’ end) and 5’RACE PCR (5’ end).  PCR will be used to clone pre-miR397a.  The sequences will undergo Bioinformatic analysis before being used to construct expression vectors.  The recombinant expression vector harbouring the Laccase gene will be used to transform tobacco via the Agrobacterium-mediated method.  Overexpression of this gene will open new insights on the possible role it might have during abiotic stress response.

1. Background

Abiotic stresses are the environmental conditions that reduce plant growth development and yield below expected levels such as drought, salt, alkali, frost among others. Drought is regarded as one of the major devastating environmental stresses which hampers plant productivity most compared to other stresses (Lambers et al., 2008).  It drastically affects plant growth and development by reducing cell division and expansion rate, leaf size, stem and root elongation, plant water nutrient relation and water use efficiency (Li et al., 2009; Farooq et al., 2009). Salt stress is well known to affect all processes in a plant’s life cycle from germination to yield.  It causes ion imbalance and hyperosmotic stress which affects the physiology of the plant (Zhu, 2001). These stresses influence various plant species to employ molecular, physiological and morphological ways of tolerance in order to survive (Cramer et al., 2011). The advancements in the field of molecular biology have revealed that different plant species are capable of responding to abiotic stresses at transcriptional and post transcriptional level.

1. Effects of salt stress on plants growth

Salt stress is one of the major environmental factors that limit plant growth and productivity.  It has adverse effect on germination, plant vigor and yield (Munns and Tester, 2008).  High salinity levels affect plants in various ways such as ion toxicity, water stress, oxidative stress, nutritional disorders, membrane disorganization, reduction of cell division and expansion and alteration of metabolic processes (Munns, 2002; Zhu, 2007).  During growth and development of plants, all major processes such as protein synthesis, photosynthesis, energy and lipid metabolism are affected (Parida and Das, 2005).  After exposure to salt, plants experience water stress which in turn reduces leaf expansion. During long-term exposure to salt stress, plant undergo ionic stress which can lead to premature senescence of adult leaves in order to reduce the photosynthetic area available to support growth (Cramer and Nowak, 1992).  Excess sodium and chloride have the potential to affect plant enzymatic activities resulting in reduced energy production levels (Munns, 2002). In maize, salt stress reduces shoot and root growth by suppressing leaf initiation and expansion, internode growth (Akram et al., 2010; Qu et al., 2012) and rate of cell elongation (Szalai and Janda, 2009) Several plant species have evolved several mechanisms either to exclude salt from their cells or to tolerate its presence inside the cells.  Exploitation of genetic variations and generation of transgenic plants with novel genes or altered expression levels of the existing genes are ways in which plants can respond to salt stress.

Abscisic acid (ABA) plays an important role in response of plants to salt stress (Xiong et al., 2001).  Salt stress signaling through ABA mediate the expression of late embryogenesis-abundant (LEA)-type genes including the dehydration-response element (DRE)/ C-repeat (CRT) class of stress-responsive genes Cor.  Hence, the activation of LEA-type genes may actually represent damage repair pathways (Xiong et al., 2002).  ABA dependent and independent signaling pathways mediate the salt and osmotic stress regulation of LEA gene expression.  ABA-dependent and –independent transcription factors might also cross-talk to each other to amplify the response and improve salt stress tolerance.

Use of genetic manipulation approaches is required to unravel the mechanisms involved in salt response and to develop salt-tolerant plants which better cope with increasing soil salinity (Rajendran et al., 2009)

1.2 miRNA literature review

1.2.1 Plant miRNA research trend

miRNAs constitute a group of endogenous, single stranded, non-coding regulatory RNAs of about 19-24nt in length. They negatively regulate various developmental, molecular and physiological processes in plants.  Plant miRNAs are involved in development, metabolic processes, hormone regulation, biotic and abiotic mediated stress response (Khraiwesh et al.,2012; Sunkar et al., 2012) and in the self-regulation of miRNA biogenesis.   This is usually done by target mRNA slicing, cleavage (transcriptional) and translational inhibition.  Target sites share high sequence complementarity to the respective miRNA and are often in coding regions though there are exceptions in the 3’ UTR (Bartel, 2004).  By regulating their target proteins, miRNAs have been reported to be involved in diverse biological processes, including organ development, hormone signaling, defense against pathogens, and response to abiotic and biotic stresses.  Important abiotic stresses in this regard include salinity, drought, cold, and heavy metals, nutrition, and other stresses.  Almost all of these stress-induced miRNAs are evolutionarily conserved, which suggests that miRNAs-mediated regulatory mechanism may be evolutionarily conserved for corresponding environmental stresses in plants. However, the same miRNAs reported to respond abiotic stress in one certain species may not have the same function in other species (Sunkar and Zhu, 2004).

1.2.2 miR397a family

miR397 family is a conserved small family of miRNAs which constitutes of three members (miR397a, miR397b and miR397c).  These members are isoforms of miR397 differing by 1-3 nucleotides in their mature miRNA sequences.  miR397 in most of the plant species has the same mature miRNA sequence (UCAUUGAGUGCAGCGUUGAUG) which differ from the former by 2-3nt (Shen et al., 2010).  Phylogenetic analysis of miR397 family was done by Shen et al., 2010 and it has been observed that 10 different plant species revealed several members that tend to be more closely related to those from other plant species than from the same plant species, implicating that evolution of the miR397 family occurred before the separation of these species.  Known target genes of miR397 in Arabidopsis and Oryza sativa include tubulin beta-6, Laccase, Casein kinase and ß-fructofuranidase (Zhou et al., 2010; Jones-Rhoades and Bartel, 2004; Shen et al., 2010; Sunkar and Zhu, 2004). miR397 was seen to be involved in various abiotic stress responses, growth and development in various plants.  miR397 involvement in plant growth and development

1.2.3 miR397 involvement in plant growth and development

miR397 has been observed to be involved during plant growth and development.  Functional analysis has been conducted in several plant species to study miR397 interaction with its target gene (Laccases). miR397 contributes to growth and development and also has an effect on lignin synthesis and seed yield (Wang et al.,2014).  In rice, miR397 has been involved in meristem development and embryogenesis (Luo et al.,2006).  In another research, miR397 showed a high and specific expression in undifferentiated embryogenic calli, whereas displayed very low expression levels in differentiated calli and mature organs. miR397 target, Laccase, is principally involved in lignification and cell wall thickening during plant growth and development so this suggested that miR397 plays an important role in silencing of genes during meristematic development.  The induction of miR397 in pro-embryogenic cells resulted in the antagonistic repression of Laccase which plays an important physiological role in maintaining embryonic cells in a thin wall and meristematic state.  Low expression of miR397 allowed the accumulation of Laccase and this lead to the lignification of cell walls from the meristematic state to mature cell transition.

In Populus trichocarpa, Lu et al.,2011 showed that miR397 levels were high in phloem vessels, mature leaves and stem differentiating xylem as compared to young leaves, young stems and roots.  Whereas in Arabidopsis, miR397(a/b) had significantly higher expression levels in the shoot apex, Inflorescence stems, seeds and whole seedlings as compared to rosette leaves or flowers. It was proposed that miR397 is specifically expressed in vascular seed plants so as to regulate lignin formation by cleaving Laccases (Wang et al., 2014). Hence it was suggested that miR397 might have evolved together with early vascular seed plants during their transition from aquatic to terrestrial life after it was detected in a number of plant species such as Norway spruce (Yakovlev et al.,2010), Loblolly pine (Lu et al., 2007; Quinn et al., 2014) but not in Selaginella (Banks et al., 2011) and Physcomitrella (Arazi et al., 2005; Talmor-Neiman et al.,2006).

It was also discovered that miR397 overexpression increases grain size and promotes panicle branching in rice plants and this is achieved by its ability to downregulate its target gene, Laccase (Zhang et al., 2013).  Similarly, miR397b overexpressed Arabidopsis plants showed an increase in number of branches, siliques, seeds (size and number) (Wang et al., 2014).  This unlike in Populus suggested that miRNA-mediated Laccase downregulation also contributes not only in vegetative growth but also reproductive and seed formation.  Rice miR397 was characterized to be associated with the increase in grain size, weight and number which directly contributes to higher productivity. It was also suggested that rice miR397 was naturally highly expressed in rice seeds Chen et al., 2011. Such increase is likely due to the fact that rice miR397 represses the laccase gene (LAC), which is a key regulator of brassinosteroids signaling and is involved in various aspects of seed yield (Zhang et al., 2013).   This was also supported by Peng et al., 2014 when he highlighted that miR397 is a potential grain filling regulator in rice due to its downregulating of Laccase and L-ascorbate oxidase target genes. Its target gene, Laccase 4 overexpression cause a reduction in inflorescent shoot number, seed (size and number).  These findings suggest that miR397b is directly involved in growth and development in flowering plants.

To further elucidate the role played by miR397 in the post-transcriptional regulation of Laccases in plants, miR397 was overexpressed in Populus trichocarpa causing a reduction in Klason lignin.  This showed a direct regulation system of miR397 mediated lignin biosynthesis during wood formation (Lu et al., 2013).  Furthermore, miR397b overexpressing Arabidopsis plants showed a significant reduction in xylem tissues and lignin levels.  miR397b target gene, Laccase 4, was overexpressed and it showed a significant increase in lignin content (Wang et al.,2014).  These results suggested that miR397b and Laccase play a significant role in lignin content.

1.2.4 miR397 involvement in abiotic stress response

These stresses influence various plant species to employ molecular, physiological and morphological ways of tolerance in order to survive (Cramer et al., 2011).  The advancements in the field of molecular biology have revealed that different plant species are capable of responding to abiotic stresses at transcriptional and post transcriptional level.  miR397 is conserved in several plant species and is thought to be responsible for plant response to various stress conditions (Table 1).  By observing miR397 expression patterns and overexpression, progress has been made towards increasing yield, resistance to abiotic stresses, nutrient homeostasis and hormone-mediated stress.

Table 1: miR397 involvement in abiotic stress response across various plant species

Species	Drought	Salt	Cold	Copper	H2O2	Sulphate	Nitrogen	ABA
A.thaliana	↑	↑	↑	↑	↑	↑	↓	↑
P.trichocarpa		↑	↑	↑	↑	↑	↑
B.distachyon		↑	↑	↑	↑	↑	↑
I.campanulata	↓
J.pentantha	↓
S.tuberosum	↓	↓
S.melongena		↑
R.raphanistrum		↓
O.Sativa	↓	↓	↓	↑	↑	↓
E.coracana	↓
S.officinarum	↑
P.virgatum	↓	↓
P.coccineus		↓
Z.mays	↓	↓					↓

Drought is regarded as one of the major devastating environmental stresses which hampers plant productivity most compared to other stresses (Lambers et al., 2008).  It drastically affects plant growth and development by reducing cell division and expansion rate, leaf size, stem and root elongation, plant water nutrient relation and water use efficiency (Li et al., 2009; Farooq et al., 2009).  Plants in turn have methods of tolerating drought stress such as reduced water loss, enhanced water uptake and other biochemical and morphological changes (Bartel and Sunkar 2005).

miRNAs have been linked to drought stress since they are differentially expressed in this condition.  Several investigations have indicated that plant miRNAs are involved in various important physiological processes such as seed germination, stem elongation and root proliferation during drought stress (Liu et at 2007; Sunkar et al., 2007).  miR397a is also amongst the miRNAs involved during drought stress response in several species.  In Arabidopsis thaliana (Liu et al., 2008; Sunkar and Zhu, 2004), B. distachyon and sugarcane (Gentile et al., 2015), miR397a was found to be induced during drought stress (Table 1).  miR397 in Rice (Zhou et al., 2010), French bean (Nageshbabu et al., 2013), Finger millet (Nageshbabu et al., 2013b), I. campanulata, J. pentantha (Gorecha et al., 2013), S. tuberosum (Xie et al., 2010) and Switchgrass (Sun et al., 2012) was observed to be downregulated when subjected to drought stress. Laccase was reported to be the target gene in most of the species whereas ß-fructofuranidase was presumed to be rice miR397 target gene.  This gene is mainly involved in sucrose and starch metabolism suggesting that miR397 plays an important role in CO2 fixation.  This helps the plants to maintain a minimal rate of Carbon-Hydrogen manufacture to respond to drought stress (Zhao et al., 2010).

Salt stress is well known to affect all processes in a plant’s life cycle from germination to yield.  It causes ion imbalance and hyperosmotic stress which affects the physiology of the plant (Zhu, 2001).  In Arabidopsis thaliana (Liu et al., 2008; Sunkar and Zhu, 2004; Mangrauthia et al., 2013), Poplar (Zhang et al., 2009; Lu et al., 2008), B. distachyon (Lu et al., 2005, 2008), Eggplant (Zhuang et al., 2014) miR397 was found to be upregulated under salt stress but was observed to be downregulated in Zea mays (Ting and Su, 2015), Rice (Zhou et al., 2010; Khraiwesh et al., 2010; Sunkar et al., 2012; Zhao et al., 2007), Solanum tuberosum (Sun et al.,2012), Radish (Sun et al., 2015), Switch grass (Sun et al., 2012) and French bean (Nageshbabu et al., 2013) (Table 1).  miR397 was differentially regulated in the above mentioned species thereby establishing its role in the adaptation of plants to salt stress.  Its predicted target gene during the regulation was Laccase in several species which was reported to reduce root growth under dehydration (Cai et al., 2006).

Several plants, mostly those which are native to warm environments, show signs of injury when exposed to low temperatures.  Signs and symptoms of cold stress induced injuries usually begin to show from approximately 48 to 96 hours although this differs from plant to plant.  Cold stress also reduces reproductive development of plants.  However, duration of exposure and the rate of decrease in temperature are also factors affecting the response from a plant.  In Arabidopsis thaliana, during cold stress, miR397a and miR397b were upregulated (Liu et al., 2008; Sunkar and Zhu, 2004).  Using wide transcriptome analysis, it was observed that miR397 was induced during exposure to cold stress conditions (Zhou, 2008).  Laccases (AthLAC2, AthLAC4, AthLAC17) are known to be miR397 target genes and are involved in lignification.  Kruszka et al., 2012 suggested that the downregulation of Laccase genes by miR397 might be part of a complex response which leads to the production of molecules which can be used for plant protection from cold.  Using high-throughput sequencing experiments, miR397 was significantly upregulated and its target gene downregulated under cold stress in Brachypodium distachyon (Zhang et al., 2009) (Table 1).  In 2014, Dong and Pei overexpressed miR397 in Arabidopsis thaliana and the resultant phenotype of plants showed resistance to chilling and also appeared larger in size as compared to the wild type plants after low temperature treatments.  Cold regulating genes such as the Cold regulated (COR) gene family and CBF transcription factors were significantly higher in miR397-overexpressed transgenic plants thereby suggesting the contribution of miR397 in the cold signaling pathways.

It has been seen that several abiotic stresses trigger the accumulation of Reactive Oxygen Species which can cause oxidative damage to cells and sometimes cell death (Mittler, 2002). In rice, miR397 was found to be upregulated in response to oxidative stress and its target gene (validated to be Laccase) was downregulated.  It was suggested that the downregulation of Laccase by miR397 minimizes the rate of biological processes which are nonessential and in turn save energy for tolerance and conserve copper which is used in several essential functions under severe stress (Li et al., 2010).  In Arabidopsis thaliana (Sunkar and Zhu, 2004), Brachypodium distachyon (Ranocha et al., 2002; Zhang et al., 2009) and Poplar (Zhang et al., 2009; Lu et al., 2008), miR397 was also observed to be upregulated after exposure to oxidative stress and the target gene was downregulated in an effort to increase tolerance of the species.

ABA is a stress responsive plant phyto-hormone.  It is well-known to regulate the expression of many genes in response to other environmental stresses.  Under stress conditions it usually accumulates within the plant enhancing the production of Reactive Oxygen Species (ROS).  Both ABA and ROS accumulation function as a stress signal that induces expression of antioxidant genes enhancing tolerance to the stress condition (Wei et al., 2009).  Recent evidence indicates that miRNAs and ABA affect each other and that the expression levels of some miRNAs are regulated by ABA (Duan et al., 2016).  miR397 has shown to be expressed in various plant species during ABA stress.  In Arabidopsis, miR397 was found to be upregulated during ABA stress (Sunkar et al.,2012; Sunkar and Zhu, 2004; Bej and Basak, 2014).

miR397 plays a significant role in plant nutrient regulation.  Copper is an essential micronutrient used by plants in various structural and biochemical ways such as cell wall metabolism, ethylene perception, oxidative stress protection and also as a co-factor protein involved in electron transfer reactions during photosynthesis and respiration (Burkhead et al., 2009).  During copper deficiency in Arabidopsis, miR397 is significantly upregulated whereas its target genes (AthLAC2, AthLAC4 and AthLAC17) are downregulated.  In rice, an increase in the level of miR397 was observed under copper deficiency conditions. It was proposed that as a way of adjusting the Copper homeostasis in the plant, miR397 targets and downregulates the expression of Copper Dismutases, Laccases and plantacyanin so as to conserve the available amounts of copper for more essential proteins such as cytochrome c and plastocyanin thereby facilitating the release of copper and restore it to optimum levels (Kruszka et al., 2012; Chun et al., 2005; Yamasaki et al.,2007; Abdel-Ghany and Pillon, 2008).  Due to such biochemical changes, the plant begins to implement the morphological adaptations by utilising and recycling the copper from the senescing leaves.

Nitrogen deficiency in maize downregulated miR397 and antagonistically this triggered the upregulation of two Laccase gene family members.  The two target genes in maize, the showed high sensitivity (Liang et al., 2012). The upregulation of the target genes caused various responses in plants such as their involvement in the reduction of root growth, energy metabolism and scavenging of oxidative species produced during stress (Xu et al., 2011).

miR397 possible plant nutrient crosstalk mediation was observed in nutrient homeostasis especially during Copper and Nitrogen deficiency as these two stresses proved to antagonistically influence each other thereby influencing the expression levels of miR397 during nutrient homeostasis (Liang et al., 2012).   Low levels of a mineral element often affect absorption of other mineral elements and this phenomenon was observed when Copper starvation-induced miRNAs were suppressed by N starvation.  miR397 was upregulated during low copper stress but further downregulated in low N conditions.  It was suggested that the signaling molecules which are involved in Copper uptake were highly repressed in these low N conditions.  It is highly imperative to look into the miR397 plant nutrient crosstalk mediation and further improve independent nutrient uptake during homeostasis.

In a study, 58 significant co-stress responsive maize miRNAs were identified and a library was constructed.  In this research, miR397a was significantly downregulated seven fold under co-stress treatment (Ting and Su, 2015).  These results coincided with those published on rice and finger millet. (Table 1.1)

1.3 miR397a target gene (Laccase) literature review

1.3.1 Laccase gene research progress

Laccases (EC 1.10.3.2) are copper-containing enzymes that have been studied in several organisms and have been proposed to participate in several physiological processes. It is conserved in plants, fungi, insects and bacteria.  Laccases have been to be observed in several industrial applications, such as lignin degradation (Hood et al., 2003), soil detoxification (Sonoki et al., 2004) and polymerization (Bailey et al., 2004).  Isolation and characterization of Laccases has been done in several species such as Arabidopsis thaliana (Berthet et al., 2011), loblolly pine (Sato et al.,2001), Poplar (Lu et al., 2013), Zea mays (Capparos-Ruiz et al., 2006), and cotton (Wang et al., 2004).  Characterization has mainly been done in relation to lignification and enzyme activity.  Seventeen genes that code for putative laccases have been found in the rice database (http://rgp.dna.affrc.go.jp/IRGSP/).  Five laccases namely ZmLAC1 (AY897208) (Liang et al., 2006), ZmLAC2 (AM086214), ZmLAC3 (AM086215), ZmLAC4 (AM086216) and ZmLAC5 (AM086217) have been identified in a maize root library (Caparros-Ruiz et al., 2006).  Forty-nine laccase gene models were identified in poplar (Lu et al., 2013) and seventeen were found in Arabidopsis (Berthet et al., 2011).  Amongst the seventeen, eight were expressed in the stem and this suggested functional redundancy of laccases in lignin polymerization.  In different studies, Laccases were reported to be induced following exposure to NaCl in tomato (Wei et al.,2000) and maize (Liang et al., 2006).  This suggests and raised the possibility of laccase being involved in salt stress response.

1.3.2 miR397a-mediated regulation of Laccase

The Laccase gene family is regulated post-transcriptionally by multiple miRNAs.  In Arabidopsis thaliana, four miRNAs were observed to target Laccase gene family members namely miR408, miR398, miR397 and miR857.  The miR397 family was observed to target three Arabidopsis Laccase gene family members (AthLAC2, AthLAC4 and AthLAC17) (Salah et al., 2008; Li et al., 2010; Sunkar and Zhu, 2004) (Fig 1.1).  Previous research has also confirmed the miR397a-mediated regulation of Laccase in various species such as rice (Zhang et al., 2013) and poplar (Lu et al., 2013).

Fig 1.1 Experimental validation of miR397a target genes in Arabidopsis thaliana.  The target gene cleavage sites were determined by 5’RNA ligase-mediated RACE. (Salah et al., 2008)

1.4 Theoretical significance and application

The world population continues to grow and so is the food demand.  Maize has been a crop with a high consumption the world over since it is used to alleviate famine and starvation in Africa as a whole and other developing countries around the world.  Abiotic stresses conditions have caused serious yield losses and this has led to decrease in the food supply chain with the growing world population.  This research on miR397a and Laccase genes highly promises understanding of the diversity and specificity of maize plant responses to different stresses.  miR397a and Laccase gene cloning and characterization will help to provide a theoretical and functional understanding to further study on the role of these two genes in abiotic stress resistance.

1.5 Aim and Objectives

Zma-miR397a and its target gene, Zma-LAC were downregulated and upregulated respectively during exposure to co-stress treatment of drought, salt and alkali in our lab.  This research will aim to reveal the expression and functional analysis of Zma-miR397a and Zma-LAC in maize and tobacco respectively.  The expression pattern analysis of the two genes under various abiotic stresses and in different maize plant tissues will be investigated.  In this study, we will also clone Zma-miR397a and Zma-LAC and further transform tobacco plants so as to lay a theoretical foundation of their function in alleviating abiotic stress.

2 miR397a and Laccase gene expression pattern analysis in maize

2.1 Experimental materials

2.1.1 Plant materials and Abiotic stress treatments

Zheng 58 Z. mays inbred were used in this research on abiotic stress.  Maize seeds were placed in 65°C water in a 500ml flat-bottomed flask.  The water temperature was allowed to drop o room temperature while stirring the flask.  Seeds were transferred to a wet paper towel and allowed to germinate in a damp and dark place under room temperature.  After approximately 5 days, the resultant germinated seedlings were transferred to silicon sand in small pots and were grown in an incubation chamber under the following conditions: temperature 24°C/20°C (day/night); photoperiod 16h/8h (day/night); humidity 60%.  Further experiments were done after the seedlings had3 leaves and one heart approx. 7days.  The maize plants were subjected to different abiotic stresses (NaCl, Drought, Cold, Na2CO3), phyto-hormones (Salicylic Acid, Abscisic Acid) and nutrient deficiency (Potassium deficiency).  25% PEG6000 was used to simulate drought conditions, 200mM NaCl for salt, 50mM Na2CO3 for alkali, 4°C for low temperature, 100mM ABA and 150mM Salicylic Acid(SA) for phyto-hormonal treatment.  All treatments were done in full strength Hoagland nutrient solution.  Potassium (K+) deficiency was done in Hoagland nutrient solution without the macronutrient K+.  The duration of the treatment was 24h separated among 6 material collection time points (0h, 1h, 3h, 6h, 12h and 24h).  All treatments were done in triplicate to ensure reliability.  Roots and shoots were collected from 3 plants at every collection time point, mixed and frozen in liquid nitrogen prior to storage in a -80°C freezer for subsequent RNA extraction.

2.1.2 Laboratory Reagents used

Trizol (RNAiso Plus), PrimeScriptTM RT reagent kit with gDNA Eraser (Perfect for Real-Time), SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2X), Easy Dilution (for Real-Time PCR) (Takara); RNase free water, PEG6000, NaCl, anhydrous Na2CO3, ABA (Sangon Biotech.Co., Ltd); SuperScriptIII reverse transcriptase (Invitrogen by ThermoFisher Scientific); Primer synthesis (Invitrogen Biotechnology by ThermoFisher Scientific Co., Ltd)

2.1.3 Laboratory Equipment

Laminar Air-Flow Cabinet(CA-1390-1), Phannaeia Biotech Image Master VDS, microwave oven (WP800TL23-K3) Galanz, China Co., Ltd, NanoDrop 2000c (Thermo Scientific Co., Ltd Shenyang, China), Thermal cycler TP600 (Takara)

2.2 Methodology

2.2.1 RNA extraction

1. Collect 15-30mg of fresh plant material (roots or shoots) and immediately transfer into mortar, add liquid nitrogen, then crush with pestle to homogenize until powdery.  Add the fine powder to a 1.5ml centrifuge tube with 1ml of RNAiso Plus and mix vigorously.  Allow the mixture to homogenize for 5-10min at room temperature.
2. To the solution from above, add 0.2ml chloroform per 1ml of RNAiso Plus.  Cap the centrifuge tube and mix until solution becomes milky. Keep the solution at room temperature for 10minutes.
3. Centrifuge at 12000X g for 15minutes at 4°C.  The solution will separate into three layers; top liquid layer (contains RNA), semisolid middle layer (mostly DNA), and bottom organic solvent layer.
4. Transfer the top liquid layer to new 1.5ml centrifuge tube without touching the middle layer.
5. Add 1ml of isopropanol per 1ml of RNAiso Plus used for homogenization and mix well.  Keep the mixture at room temperature for 10minutes.
6. Centrifuge at 12000X g for 15minutes at 4°C to precipitate the RNA
7. Carefully remove the supernatant.  Add 1ml of 75% cold ethanol and vortex.  Centrifuge the solution at 8000X g for 5minutes at 4°C and discard the supernatant (Repeat this process twice)
8. Dry the precipitate by leaving the tube open for several minutes and add 20µl RNase free water
9. Analysis by absorbance is done by measuring 1ml of dissolved RNA using NanoDrop 2000 and further diluting the stock to a concentration of 500ng/µl.
10. Analysis of RNA purity is done by agarose gel electrophoresis

2.2.2 qRT-PCR Primer design

Primers were designed according to the existing sequence of Zea Mays B73 which was found in NCBI Database.  The target gene (Laccase) primers, LAC-F and LAC-R for Real-Time quantitative PCR(qPCR) were designed using IDT Primer Quest Tool.  Stem loop RT-qPCR primers containing a specific extension at the 3’ end that is the reverse complement of the last seven nucleotides at the 3’ end of miR397a products.  The forward primer miR397a-F was specific to the miR397a mature sequence.  The universal reverse primer, miRNA-R is specific to the 5’ end of the stem-loop RT primer.  miR172 and U6 were used as endogenous normalized genes.  Primer sequences are shown in a table below.

Primer name	Primer Sequence（5′ -3′）
LAC-F	GGTTTGGTGTTATGCTTCCATTTAG
LAC-R	CTAGTAGCATCAACGGACCTTC
miR397a-F	TCATTGGTGTTATGCTTCCATTTAG
miR397a-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCA
miR172-F	GCCGGCGAATCTTGATGATGC
miR172-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGCAGC
miRNA-R	GTGCAGGGTCCGAGGTATTC
ZmU6-F	TTGGAACGATACAGAGAAGATTAGC
ZmU6-R	AATTTGGACCATTTCTCGATTTGTG

2.2.3 Total RNA extraction from Z. mays and first strand cDNA synthesis

Total RNA from abiotic stress treated Z. mays Zheng58 was extracted using the RNAiso reagent protocol by the manufacturer.  Quantity and quality of RNA was determined by Nano Drop 2000 and concentration was set to 500ng/µl.  The purity analysis of RNA was done by agarose gel electrophoresis.

1. PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) was used for reverse transcription of target gene cDNA.  The following protocol was used:

1. Genomic DNA elimination reaction (reaction prepared on ice)

5X gDNA Eraser Buffer                                                                2µl

gDNA Eraser                                                                                  1µl

Total RNA                                                                                       2µl

RNase Free dH2O                                                            Up to 10µl

Reaction conditions for themocycler: 42℃ 2 min

1. Reverse-transcription reaction (reaction prepared on ice)

Reaction solution from step 1)                                                10µl

5X PrimeScript Buffer 2 (for Real Time) 4µl

PrimeScript RT Enzyme Mix I 1µl

Master mix

RT Primer Mix 4µl

RNase Free dH2O                           Up to 20µl

Reaction conditions for thermocycler: 37℃   15 min

85℃   5 s

4℃   ∞

1. SuperScript ™ III reverse transcription reaction kit was used for miRNA reverse transcription. The following protocol was used:

1. Total RNA                                                                           8μl

2.5mM dNTP Mix                                                            4μl

Gene-specific primer（2 pmol/μL）                               1μl

Reaction conditions for thermocycler: 65℃     5min

Place on ice:   1min

1. Reaction solution from step 1)

5×First-stand Buffer                                                            4μl

0.1 DTT                                                                                         1μl

RNase OUT                                                                           1μl

SuperScript™ III RT                                                             1μl

Reaction conditions for thermocycler: 55℃   60min

70℃   15min

4℃   ∞

2.2.4 qRT-PCR

real-time PCR using SYBR® Premix Ex Taq II (Tli RNaseH Plus) kit was used as described by the manufacturer.  Target gene and miRNA cDNA was diluted 5-fold and 10-fold respectively after standard curve analysis.  The qRT-PCR reaction was prepared as follows:

SYBR Premix Ex Taq II (Tli RNaseH Plus) (2X)                                    12.5 μl

PCR Forward Primer (10 μM)                                                                1.0 μl

PCR Reverse Primer (10 μM)                                                                 1.0 μl

RT reaction solution (cDNA)＊2                                                           2.0 μl

Sterilized purified water                                                                        8.5 μl

qRT-PCR optimal reaction conditions: Hold (initial denaturation)

Cycle：1

95℃ for 20 sec

2 Step PCR

Cycle：40

95℃ for 5 sec

60℃ for 20 sec

Dissociation

The ddCT method was used to analyse relative gene expression.  All reactions were done in triplicate (Biological and technical)

2.3 Results and analysis

In order to study the expression pattern of miR397a and its target gene, Laccase, in different abiotic stresses, real-time PCR was performed on the leaves and roots of the maize plants at different time points (0h, 1h, 3h, 6h, 12h, 24h).  Abiotic stress treatments which were investigated include PEG 27% (Drought), NaCl 200mM (Salt), Na2CO3 50mM (Alkali), ABA 100µM (Hormone), Salicylic acid 50µM (Hormone), Cold 4˚C and Potassium (K+) deficiency.  Root samples and shoot samples (stem and leaf) underwent through RNA extraction procedures.  The RNA was tested for quality and reverse transcribed to cDNA prior to qualitative real-time PCR.  The relative expression of miR397a and Laccase was measured and analyzed. Following similar protocols as above, the miR397a and Laccase gene expression were analyzed in different tissues during maize growth from juvenile to reproductive stage.  Particular tissues which were investigated include leaf, root, stem, silk, tassel and immature seed and these were collected at different stages of maize growth.  This was also done to see the relative abundance of the two different genes in these different tissues during growth.

2.3.1 miR397a and Laccase gene expression during abiotic stress treatment

1) miR397a and Laccase relative expression during Drought stress treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.1).

M            1            2            3            4            5            6            7            8            9           10          11          12

Fig 2.1 Total RNA of Drought stress treated Z. mays seedlings

M) DL2000 Marker; 1-12) PEG treated maize plants

Expression pattern of miR397a and Laccase in drought stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under drought stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots. In the shoots, miR397a was down regulated throughout the entire period of drought treatment whereas Laccase was upregulated at all-time points.  In roots, the transcript levels of miR397a were low throughout the drought stress treatment meaning that the gene was downregulated in response to PEG. Laccase was upregulated rapidly after treatment with PEG from 1h and reached a maximum at 24h.  The expression pattern of the two genes showed an expected inverse pattern of expression (Fig 2.2a and b).

a

b

Fig 2.2 Expression of miR397a and Laccase genes during drought stress. Analysis by qRT-PCR of Laccase and miR397a in untreated and drought-stress treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated plants calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

2)miR397a and Laccase relative expression during Salt stress treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR Fig 2.3

M            1            2             3            4            5           6             7             8            9          10          11          12

Fig 2.3 Total RNA of Salt stress treated Z. mays seedlings

M) DL2000 Marker; 1-12) NaCl treated maize plants

Expression pattern of miR397a and Laccase in Salt stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under salt stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b). miR397a was downregulated in shoots whereas Laccase was upregulated rapidly under NaCl treatment as the transcription levels peaked at 3h and 12h and then declined at 24h.  In the roots, miR397a was downregulated but Laccase was upregulated during exposure to salt stress.

a

b

Fig 2.4 Expression of miR397a and Laccase genes under salt-stress. Analysis by qRT-PCR of Laccase and miR397a in untreated and salt-stress treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated plants calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

3) miR397a and Laccase relative expression during Alkali stress treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 1.5).

M                        1           2          3           4          5           6           7         8           9         10         11         12

Fig 2.5 Total RNA of Alkali stress treated Z. mays seedlings

M) DL2000 Marker; 1-12) Na2CO3 treated maize plants

Expression pattern of miR397a and Laccase in Alkali stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under alkali stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots.  In shoots, miR397a was gradually downregulated from 1hr to 24hrs whereas Laccase was upregulated rapidly and reached a peak at 12h of Na2CO3 stress treatment.  In the roots, miR397a was downregulated throughout the stress treatment period but Laccase was induced and reached a peak at 12h (Fig 1.6a and b).

a

b

Fig 2.6 Expression of miR397a and Laccase genes under alkali stress. Analysis by qRT-PCR of Laccase and miR397a in untreated and alkali-stress treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated plants calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

4) miR397a and Laccase relative expression during ABA stress treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.7).

M           1            2            3           4            5            6            7           8            9           10          11         12

Fig 2.7 Total RNA of ABA stress treated Z. mays seedlings

M) DL2000 Marker; 1-12) ABA treated plants

Expression pattern of miR397a and Laccase in ABA stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under ABA stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots.  For ABA treatment, miR397a was downregulated gradually throughout the phyto-hormonal treatment whereas Laccase was induced and reached a peak at 12h in the shoots.  In the roots, miR397a was downregulated during all time points whereas Laccase was induced rapidly under ABA treatment and peaked at 12h but showed a slight decrease (but still upregulated) at 24h.  The expression of both genes showed antagonism which is consistent of the miRNA-target gene expression pattern (Fig 2.8a and b).

a

b

Fig 2.8 Expression of miR397a and Laccase genes under ABA treatment. Analysis by qRT-PCR of Laccase and miR397a in untreated and ABA treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated plants calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

5)miR397a and Laccase relative expression during Cold stress treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.9).

M 1             2            3            4            5            6             7            8            9            10          11         12 

Fig 2.9 Total RNA of low temperature stress treated Z. mays seedlings

M) DL2000 Marker; 1-12) Cold treated maize plants

Expression pattern of miR397a and Laccase in low temperature stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under low temperature stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots. During low temperature stress treatment, miR397a was downregulated throughout the treatment period and Laccase was upregulated as it reached a peak at 6h in shoots and with time, the transcript levels decreased but was still upregulated.  In the roots, miR397a was downregulated uniformly across the treatment time points whereas Laccase levels increased (upregulated) and reached the peak at 12h of treatment (Fig 2.10a and b).

a

b

Fig 2.10 Expression of miR397a and Laccase genes under low temperature stress. Analysis by qRT-PCR of Laccase and miR397a in untreated and low temperature stress treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated seedlings calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

6) miR397a and Laccase relative expression during Potassium (K+)deficiency treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.11).

M       1         2        3        4        5        6        7        8        9       10                       M        11      12

a

 

b

Fig 2.11a and b Total RNA of Potassium (K+) deficiency stress treated Z. mays seedlings

a) M) DL2000 Marker; 1-10) K+ deficient maize plants b) M) DL2000 Marker 11-12) K+ deficient maize plants

Expression pattern of miR397a and Laccase in K+ deficiency stress treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under K+ deficiency stress in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots. Under K+ deficiency, miR397a was downregulated from 1h to 12h but showed a mild upregulation (incoherent) at the 24h time point whereas Laccase was upregulated at the 12h time point in the shoots.  In the roots, mi397a was downregulated from 1h to 3h then showed upregulation (incoherent expression) at the 6h time point but was gradually downregulated from 12h to 24h but Laccase was upregulated from 1h to 6h reaching a maximum at 3h then downregulated from12h to 24h (Fig 2.12a and b).

a

b

Fig 2.12 Expression of miR397a and Laccase genes under K+ deficiency stress. Analysis by qRT-PCR of Laccase and miR397a in untreated and nutrient deficiency treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the untreated plants calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

7) miR397a and Laccase relative expression during Salicylic acid treatment

RNA extraction and quality control

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/A280 ratio was kept at 1.8-2.0 where as A260/A230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.13).

M           1            2           3           4            5           6           7            8           9          10         11          12

Fig 2.13 Total RNA of SA treated Z. mays seedlings

M) DL2000 Marker; 1-12) SA treated maize plants

Expression pattern of miR397a and Laccase in SA treated Z. mays seedlings

qRT-PCR was used to analyse miR397a and Laccase genes under SA treatment in maize.  Results showed that both genes were differentially responsive to this stress in both a) shoots and b) roots.  In the shoots, miR397a was induced (incoherent expression) during the first hour but was eventually downregulated for the remainder of the treatment period whereas Laccase was upregulated in the first hour and then declined to a low level at 12h before reaching an abrupt peak at 24h under SA treatment.  In the roots, miR397a was mildly upregulated (incoherent expression) during the first hour of treatment before being downregulated from 3h to 24h whereas Laccase was downregulated from 1h to 3h but gradually upregulated to a maximum at 12h (Fig 2.14a and b).

a

b

Fig 2.14 Expression of miR397a and Laccase genes under Salicylic acid treatment. Analysis by qRT-PCR of Laccase and miR397a in untreated and Salicylic acid treated maize seedlings (a: shoots; b: roots).  U6 and 172 was used for normalization.  Bars represent the means ± standard error of 3 biological replicates with 3 technical replicates each.  Asterisk “*” represent significant differences from the wt calculated by the T-test 0.05 confidence level.  The expression of the untreated plants was set at 1 (not shown)

2.3.2 Expression analysis of miR397a and Laccase in various maize tissue

Total RNA extraction and analysis in various maize tissues

RNA extraction was performed using the trizol method and its concentration was measured using the Nanodrop2000c.  Total RNA concentration by A260 was maintained at 500ng/µl.  For purity, A260/280 ratio was kept at 1.8-2.0 whereas A260/230 was 2.0.  Integrity of the RNA was detected by agarose gel electrophoresis, which showed clear 28S and 18S ribosomal RNA (rRNA) bands, no nucleic acid degradation or genomic DNA.  This analysis showed that RNA integrity was standard and could undergo reverse transcription prior to qRT-PCR (Fig 2.15a and b).

Fig 2.15 Tissue expression pattern for miR397a and Laccase in maize

1. miRNA-specific and target gene qRT-PCR analysis of miR397a and Laccase respectively in different plant tissues. M) DL2000 Marker; 1) Leaf; 2) Stem; 3) Root; 4) Tassel; 5) Silk, (b) M) DL2000 Marker; 1) Seed.

Expression pattern of miR397a and Laccase in various maize tissues

qRT-PCR was done and the 2-ΔΔCT method was used to analyse the expression pattern of miR397a and Laccase genes in different maize tissues.  Results showed that both genes were differentially responsive in various tissue under investigation.  Higher levels of miR397a expression were detected in silk, seed, tassel and root compared with stem and leaf. Laccase gene transcript levels were also high in silk, tassel and roots in comparison with seed.

Fig 1.16 Tissue expression pattern for miR397a and Laccase in maize.

Analysis by qRT-PCR of miR397a and Laccase in various maize plant tissues.  U6 and miR172 were used as endogenous controls.  Bars represent the means ± standard error of 3 replicates.  Expression of leaves was set to 1.

2.4 Discussion

Abiotic stresses affect various physiological processes in plant development, such as seedling growth and seed determination.  Exposure to different abiotic stresses can lead to similar responses in plants.  Moreover, different kinds of stresses can trigger responses through the induction of miRNAs and their target genes (Sunkar and Zhu, 2004).  This suggests that plants share common signaling pathways that act in different abiotic stress responses.  The miRNAs are either induced or repressed after exposure to stress treatments and this influences plant growth and development processes (Lu and Huang, 2008).  The role of miR397a and its target gene has been established mainly in the plant response to abiotic stresses however little is known about the potential biological function in maize. The association of miR397a and Laccase with abiotic stresses has only been partially studied in different plant systems and under different stresses.  In this study, miR397a and its target gene, Laccase(LAC), were measured under 7 different conditions (abiotic stress, nutrient deficiency and plant hormones) in maize so as to obtain an overview of its possible involvement in plant growth and development.

The data in this research showed that the expression of miR397a and Laccase was repressed and induced respectively by PEG, NaCl, Na2CO3, ABA, Cold, K+ and SA which suggests that the two genes might have possible roles in plant responses to various abiotic stresses.

The results described in this research showed that Laccase was induced but miR397a was repressed during drought treatment throughout the entire treatment time points.  This gave suggestive evidence that miR397a and Laccase play an important role during abiotic stress response.  Laccases belong to the multi-copper oxidase family of enzymes.  This family member of target genes (Laccases) was observed to be involved in the reduction of root growth, energy metabolism and scavenging of oxidative species produced during stress (Xu et al, 2011).  Laccase downregulation in both shoots and roots might suggest that it plays an important role during the response to drought stress.

Clear functional involvement of miR397a and Laccase in the responses of maize to salt stress examined was supported by the results.  Laccase was seen to be induced rapidly in both shoots and roots throughout the treatment duration whereas miR397a was repressed.  Clear antagonism between miRNA and target genes was mostly observed in the roots.  Since Laccase is involved in lignification, it has a role in controlling cell elongation which could primarily help cell wall integrity as well as cell wall strength during NaCl response (Liang et al., 2006).  The expression pattern in maize however contradicts with the one in Arabidopsis since in the latter, miR397a is induced but the target gene, Laccase is repressed during salt stress.  This difference suggests that probably miR397a and Laccase gene expression are species-specific.

Unlike other stresses, alkali stress does not have substantial documentation to explain how it affects miR397a or Laccase gene expression. Soil salinization and alkalinisation frequently occur simultaneously (Kawanabe and Zhu, 1991).  Some sources even claim that alkaline salts (NaHCO3 and Na2CO3) are much more destructive to plants than neutral salts (NaCl and Na2SO4) (Shi and Yin, 1993) however, relatively little attention have been paid to alkali stress.  Salt stress mainly involves osmotic stress and ion injury (Munns, 2002) while alkali stress exerts the same stress factors but with added influence of high pH stress.  The high pH environment around the plant roots can directly cause Ca2+, Mg2+ and H2PO4– to precipitate (Shi and Zhao, 1997) and may inhibit ion uptake (Yang et al, 2007) and disrupt the ion imbalance in plant cells. In this study, Laccase was upregulated whereas miR397a was downregulated during the 24h treatment with 50mM Na2CO3.  This upregulation of Laccase could potentially be a tolerance response just like during drought and salt since alkali is also considered an osmotic stress.  S-adenosyl-L-methionine (SAM), a common substrate for many biochemical reactions in plants plays an important role in regulatory plant development and abiotic stress response.  SAM has been observed in alkali-stressed tomato (Gong et al., 2014) and has shown to improve salt stress in tobacco (Qi et al., 2010).  It was reported that salt and alkali stress induce SAM expression and subsequent SAM accumulation, which occurs predominantly in lignified tissues.  This then results in more selective and reduced Na+ uptake to compensate on the decreased bulk flow of water and solutes along the apoplectic pathway by enhancing the cell to cell pathway for water transport (Sanchez-Aguayo et al., 2004).  Since SAM concentration and activity are correlated with lignification, the upregulation of Laccase is directly involved with that particular process as well.  It might be possible that as Laccase is induced, lignin accumulates and SAM concentration and activity increases thereby responding to alkali stress.  Laccase is upregulated during this stress suggesting that it plays a significant during alkali stress tolerance.  Though the specific mechanism is unknown, it is suggested that, since Laccase is involved in lignification and other cell membrane and cell integrity functions it might also be involved in maize alkali stress tolerance.

In maize, the upregulation of laccase and downregulation of miR397a might be part of a complex response which leads to low temperature response genes which can be used for plant protection from cold.  These results contradicted to those in Arabidopsis thaliana where during cold, miR397a is upregulated and its overexpression helps the plants to tolerate low temperature stress (Dong and Pei, 2014).  This suggests that probably miRNA expression during stress might be species specific.

Reduced miR397a transcript levels and induced Laccase levels were observed upon exposure to ABA.  These results suggested that miR397a and Laccase play a role in response to ABA exposure. ABA is well-known to regulate the expression of many genes in response to other environmental stresses.  Under stress conditions it usually accumulates within the plant enhancing the production of Reactive Oxygen Species (ROS).  Both ABA and ROS accumulation function as a stress signal that induces expression of antioxidant genes enhancing tolerance to the stress condition (Wei et al., 2009).  Recent evidence indicates that miRNAs and ABA affect each other and that the expression levels of some miRNAs are regulated by ABA (Duan et al., 2016).  miR397 has shown to be expressed in various plant species during ABA stress.  In Arabidopsis, miR397 was found to be upregulated during ABA stress (Sunkar et al.,2012; Sunkar and Zhu, 2004; Bej and Basak, 2014).  This further suggests species specificity of miRNAs.

Under K+ deficiency (Fig 2.12) and Salicylic acid treatment (Fig 2.14), miR397a was downregulated but Laccase was upregulated.  This suggested that both genes might play a role in K+ deficiency and Salicylic acid.  Not much information is documented on the expression of these two genes under the previously mentioned treatments.

mi397a and Laccase were responsive under drought, salt, alkali, low temperature, ABA, K+ deficiency and Salicylic acid.  This suggests that these genes might be associated with enhancing plant stress tolerance.  During maize growth, miR397a and laccase were observed to be expressed in all investigated tissues.  High expression levels were seen in roots, tassel, silk, and seeds which suggests a role of these two genes during the reproduction in maize.  miR397a involvement in reproduction was also observed when it was overexpressed in rice (Zhang et al., 2013) and Arabidopsis thaliana (Wang et al., 2014).  It showed an increase in seed size and number in both plants.  Expression of miR397a and laccase was not proportional to the duration of treatment as expected.  In this research during different time points of treatment, transcript levels would be more after less duration and decrease after long time exposure suggesting that, miR397a might be stress duration specific.

2.5 Summary

1. Zma-miR397a and Zma-LAC were differentially expressed under various abiotic stresses for 24hrs in both shoots and roots of maize seedlings.
2. Zma-miR397a and Zma-LAC were expressed in all tissues under investigation.  The highest transcript levels were observed in the tassel, silk and immature seed as compared to leaf, stem and root.

1. Cloning and characterization of pre-miR397a

From the expression pattern analysis, it was suggested that miR397a might play a role in maize response to stress.  Overexpressed OsmiR397a and AthmiR397a were seen to improve seed size and seed number.  To further assess the role of this gene in maize, miR397a was cloned and a maize expression vector was constructed.

1. Materials and methods
   1.       Plant material

Z. mays cv. Zheng 58 was used in this research.

1.       Reagents

Taq DNA polymerase (Ex Taq, LA and PrimeStar ® Max), DNA Marker, DNA gel extraction and recovery kit, pMD18 – T carrier and 3 ‘RACE kit (Takara); RNase free water was purchased from Shanghai Sangon biological co., LTD.; SuperScript ™ III reverse transcriptase, 5’ RACE PCR kit (Invitrogen); Anhydrous ethanol, chloroform; Primer synthesis work performed by Invitrogen co., LTD. SuperScript ™ III Reverse transcriptase (Invitrogen Co. Ltd);  pEASY-Uni Seamless Cloning and Assembly (Transgene Co. Ltd. Beijing); Primer synthesis (Invitrogen)

1.       Equipment

Dry Bath thermostat (Sheng instruments Co., LTD (Hangzhou), Laminar Air Flow Cabinet (CA – 1390-1) Net purification equipment co., LTD. (Shanghai), Autoclave (TOMY), Nanodrop2000c (Thermo Scientific co., LTD. Shenyang) and PCR (TP600) (Takara Co., LTD.), Gel imaging system (Phannaeia Biotech Image Master VDS), Electronic balance (PL303) (Mettler Toledo instrument (Shanghai) co., LTD.), High speed Centrifuge (Shanghai medical analysis instrument factory), ultra-low temperature freezer (SANYO), microwave oven (WP800TL23 – K3) (Galanz Co., LTD.), Gel Electrophoresis Capillary system (DY-8c (Beijing)

1. Methodology
   1.       Genomic DNA extraction

1. Maize genomic DNA was extracted following the instructions provided by Tiangen Bio-engineering Co., LTD.  The protocol is as follows:
2. Fresh maize plant tissue is ground to powder in liquid N2. Add 400µl of FP1 buffer and 6µl 10mg/ml RNaseA, vigorously shake for 1min and leave for 10min at room temperature.
3. Add 130µl FP2 buffer and gently shake for 1min.
4. Centrifuge at 12000rpm for 5min and transfer the supernatant to a new 1.5ml centrifuge tube.
5. Add 0.7 times volume of isopropyl alcohol to the supernatant, gently mix and centrifuge at 12000rpm for 2min discard supernatant.
6. Add 600µl of 70% ethanol, vigorously shake for 5s and centrifuge at 12000rpm for 2min. Discard supernatant.
7. Repeat step 6.
8. Dry the residual ethanol at room temperature.
9. Add 25µl ddH2O to dissolve the DNA.
   1.       Zma-pre-miR397a cloning

1. pre-miR397a primer design

Based on the maize B73 sequence from NCBI, the sequence of design primer is as follows:

Zma-pre-miR397a-F: 5’-CGGGAGGTTCTTGTCGAAGG-3’

Zma-pre-miR397a-R: 5’-GACGAAGTCCCCGTCTTGTT-3’

Expected PCR fragment is 657bp.

1. Zma-pre-miR397a cloning

DNA was used as a template to amplify zma-pre-miR397a.  zma-pre-miR397a-F and zma-pre-miR397a-R were used for the PCR amplification of the gene using the following protocol:

10×PCR Buffer		5μl
dNTP Mixture	4μl
zma-pre-miR397a-F（10μM）	1μl
zma-pre-miR397a-R（10μM）	1μl
LA Taq (5U/L)	0.5μl
DNA（50ng/μl）	5μl
ddH2O	up to 50μl

PCR condition:
94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（30s）		35
72℃（10min）		1
16℃		∞

1. Agarose gel DNA extraction

After amplification of the conserved region, the PCR product was ran on a 1% agarose gel.  The expected band was extracted and purified using the MiniBEST Agarose Gel DNA Extraction Kit.  The following protocol was followed:

1) The amplicon 657bp gel band was excised under UV light prior to net weight measurement.

2) Gel was dissolved in Buffer GM by gently shaking

3) DNA was bound to a spin column/matrix by centrifugation at 12000rpm for 1min and the supernatant was discarded

4) DNA was washed by Buffer WB and centrifuged twice

5) The spin column was put in a new 1.5ml centrifuge tube at 12000rpm for 1min and left to dry.

6) 30ml of DEPC water was added to the spin column to elute the DNA

(4) T-vector cloning

Cloning of DNA into pMD18-T cloning vector protocol is as follows:

pMD18-T vector	1μl
DNA fragment（50ng/l）	2μl
Solution I	5μl
ddH2O	2μl

Reaction conditions: 16℃ for 5h

(5) Transformation of E. coli cells

1. Take DH5α competent cells out of -80°C and thaw on ice (approximately 20-30 mins).

1. Remove agar plates (containing Ampicillin) from storage at 4°C and allow to warm up to room temperature.

1. Mix 5 μl of DNA (usually 10 pg – 100 ng) into 20-50 μl of competent cells in 1.5ml centrifuge tube. GENTLY mix by flicking the bottom of the tube with your finger a few times.

1. Incubate the competent cell/DNA mixture on ice for 30 mins.

1. Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 90 secs.
2. Put the tubes back on ice for 2 min.
3. Add 1ml LB to the bacteria and grow in 37°C shaking incubator for 60 min shaking at 180rpm.
4. Plate 200µl onto LB agar plate containing 100µg/ml and incubate plates at 37°C overnight.

(6)             Positive clone screening of Bacterial clones

1. Pick E. coli single colonies from the petri dish and place them in a centrifuge tube with LB medium supplemented by Ampicillin.  Shake the centrifuge tube at 180rpm for 5hours.
2. Transfer 200µl from to a new centrifuge tube and centrifuge at 10000rpm for 1min.  Discard supernatant.
3. Add 30µl of sterile ddH2O to the centrifuge tube and place it in a dry bath at 98°C for 15mins.
4. Centrifuge at 10000rpm for 1min.  Pipette 2µl and use it as a PCR template.

The PCR reaction is as follows:

10×PCR Buffer	2 μl
dNTP Mixture	2 μl
Zma-pre-miR397a-F (10μΜ)	1μl
Zma-pre-miR397a-R (10μΜ)	1μl
Ex Taq（5U/l）	0.2μl
PCR template(supernatant)	2μl
ddH2O	up to 20μl

Thermo cycler reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）			35cycles
72℃（10min）		1
16℃		∞

PCR results were detected and analyzed on `1% agarose gel electrophoresis

Zma-pre-miR397a gene sequence analysis

Positive clones were sequenced and the resultant sequence was run in BlastN against the B73 pre-miR397a sequence.

1.       Maize expression vector construction

Primer sequence containing the vector sequence is as follows:

Zma-pre-miR397a-J: 5’-GGATCCAACAGCCCCCGGGAGGTTCTTGTCGAAGG-3’

Zma-pre-miR397a-S: 5’-TTCGAGCTCGCTGTTGACGAAGTCCCCGTCTTGTT-3’

Zma-pre-miR397a flanked by the partial vector sequence was amplified by the above

mentioned primers.

1. Plasmid propagation

E. coli cells containing pTF101-35s expression vector was taken from the -80℃ cryogenic freezer.  It was allowed to thaw on ice and thereafter plated on solid LB medium supplemented by Spectinomycin.   It was incubated at 37℃ overnight.  A single colony was picked and put in liquid LB medium supplemented by Spectinomycin.  It was incubated on a 37℃ shaking bed at 180rpm for 12 to 16h.

2)    pTF101-35s plasmid extraction

a).  Transfer 1.4-5 mL of bacterial cultures to a sterile microcentrifuge tubes.

Mix each culture well before taking the cells. Many cells will have sunk to the

bottom of the tube.

b).  Centrifuge for 2min at 8000g.

c).  Resuspend the pelleted bacterial cells in 250 μl of Buffer P1.

d).  Add 250 μl of Buffer P2 and shake the tube immediately (and gently) 10 times.  DO

NOT VORTEX!

e).  Add 350 μl of Buffer P3 and mix by inverting several times.

f).  Centrifuge for 10 minutes at 12000g.  A white pellet will form.

g).  Discard the supernatant and centrifuge for 30s at 8000g.  Discard the supernatant.

h).  Add 500µl Wash solution and centrifuge at 9000g for 30s.

i).  Discard the flow-through, and centrifuge for an additional 1 min to remove

residual Wash solution.

j).   Place the column in a clean 1.5ml microcentrifuge tube.  To elute DNA, add 50 μl

water to the center of each column, let it stand for 1 min, and then centrifuge for 1 min.

1% agarose gel electrophoresis is used to detect quality of plasmid.

3)  Plasmid restriction enzyme digestion

Two restriction enzymes (BamHI and SpeI) were used to cut the pTF101-35s plasmid.                    The reaction was as follows:

pTF101-ubi（500ng/μl）	10μl
10×T buffer	10μl
BamHI	5 μl
SpeI	5 μl
0.1%BSA	10μl
ddH2O	up to 100μl

Enzyme reaction conditions:  37°C    6h

1% Agarose Gel electrophoresis was used for the detection of enzyme products.        MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0 DNA recovery Kit was used for gel extraction and purification following the protocol described at 3.2.2 (3).

4) pTF101.1-ubi-pre-miR397a construction

The recombinant expression vector was used to transform E. coli competent cells.  Positive

clones were screened by PCR.  The PCR result was run on 1% agarose gel and positive

bacterial clones were sent for sequencing to Invitrogen.

5) Recombinant plasmid extraction

E. coli cells harbouring the recombinant expression vector were grown in LB liquid media at 180rpm for 12h.  The recombinant plasmid was extracted following the protocol on 3.2.3.

6) Agrobacterium tumefaciens preparation

a. Agrobacterium tumefaciens EHA101 is taken from -80 ℃ ultra-low temperature freezer and grown on solid YEP media supplemented by 50 mg/l kanamycin and 5 mg/l rifampicin in 28℃ for 48h.

b. Pick a single colonies of bacteria and grow them in liquid YEP medium supplemented by kanamycin and rifampicin at 180rpm in 28℃ overnight.

c. The bacteria is transferred to liquid YEP media without antibiotics at the ratio of 1:100.  The Bacterial solution is shaken at 180rpm in 28℃ until it reaches OD600 0.3-0.5.

d. The above microbial solution is placed on ice for 30 min and centrifuged at 4000rpm in 4℃ for 10mins.  Discard the supernatant.

e. Add 4 ml of 20mM CaCl2 solution to the pellet and centrifuge.  Discard the supernatant.

f. Add 1ml ice cold 20mM CaCl2 solution to the pellet, add 50% glycerol to 1.5 ml of centrifuge tube.  Resuspend cells in this mixture and transfer to the cryogenic refrigerator for later use.

7) Transformation of A. tumefaciens with plasmid DNA

a. Add 1-2µg of plasmid DNA to one tube containing Agrobacterium cells.  Mix by tapping with your finger gently.

b. Freeze tubes in liquid Nitrogen for 1min, then thaw tubes for 5 min @ 37°C.

c. Add 1ml of YEP liquid medium and shake at 180rpm for 4-5h in 28°C.

d. Centrifuge the bacterial solution and discard 200µl of the supernatant.  The remaining solution should be suspended in the tube.  200µl is spread plated on a petri-dish containing solid YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin and grown for 36h in 28°C.

e. Pick a single colony and suspend in 1ml YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin at 180rpm in 28°C overnight.

8) Positive clone screening

Pipette 200µl of bacterial solution and centrifuge at 12000rpm for 1min.  Discard

supernatant and add 30µl DEPC water.  Place in liquid Nitrogen for 10mins and then transfer to a 98°C dry bath for 5min.  Repeat this process again.  PCR is done using bar gene primers and zma-pre-miR397a primers.

3.3 Results and analysis

3.3.1 Cloning of pre-miR397a

For pre-miR397a cloning, maize plant genomic DNA was isolated.  A pair of primers was used to amplify the pre-miR397a which was flanked by the additional base pairs on both ends of the sequence.    The PCR product was 657bp (Fig 3.1a).  The upstream and downstream base pairs were added so as to protect the miRNA and facilitate pre-miRNA processing.  The amplified fragment was then inserted into the pMD18-T vector and E. coli cells were transformed.  The presence of the sequence was verified by using the pre-miRNA primers and the sequencing primers Fig 3.1.  Positive clones were confirmed by sequencing and the full pre-miR397a sequence containing the additional flanking region was obtained.

Fig 3.1: Pre-miR397a gene cloning

a) pre-miR397a PCR product (657bp)

b) 1-4) PCR detection of transformed E. coli cells using sequencing primers (RVM and M13) (747bp)

c) 1-4) PCR detection of transformed E. coli cells using pre-miR397a gene specific primers (657bp)

3.3.2 Zma-pre-miR397a sequence analysis

Zma-pre-miR397a sequencing results were run in NCBI BlastN and showed a 100%sequence identity.  The pre-miR397a sequence was 143bp flanked by 226bp upstream and 288bp downstream Fig 3.2.

Fig 3.2. pre-miR397a sequence (Red: pre-miR397a, Black: 5’ and 3’ flanking region)

3.3.3 Plant expression vector construction

After sequencing, a pair of primers was designed in preparation for seamless cloning.  The amplified fragment had an additional part sequence of the expression vector (Fig 3.3a.).  The expression vector was digested by SpeI and SmaI restriction enzyme (Fig 3.3b).  The fragment was cloned in the SpeI and SmaI restriction enzyme sites of the expression vector pTF101.1-ubi using seamless cloning.  E. coli cells were transformed and positive clones were screened by PCR using pre-miR397a internal primers (Fig 3.4).

    M                  1

(b)

(c)

Fig 3.3: Plant Expression vector construction

a) Agarose gel electrophoresis of pre-miR397a with partial vector sequence PCR product

b) M) λ-EcoT14 I digest marker, 1) pTF101.1-35s plasmid digested by SmaI and SpeI

c) Schematic structure of the recombinant pTF101.1-ubi-pre-miR397a construct

Fig 3.4 Agarose gel electrophoresis of transformed E. coli cells

M) DL2000 marker; 1-6) PCR detection of transformed A. tumefaciens cells using pre-miR397a

gene specific primers

3.3.4 Transformation of A. tumefaciens with recombinant plasmid DNA

The recombinant construct was transferred from E. coli cells to Agrobacterium.  Transformation of A. tumefaciens with pTF101.1-ubi-pre-miR397a vector was done using the heat shock method.  Positive clone detection was done by PCR using bar gene primers and pre-miR397a gene specific primers Fig 5a and b.

Fig 3.4: Agarose gel electrophoresis of transformed A. tumefaciens cells

a) PCR detection of transformed A. tumefaciens using bar gene primers M: DL2000 marker; 1) pTF101.1-ubi-pre-miR397a; 2, 3, 4) PCR products of positive clones

b) PCR detection of transformed A. tumefaciens cells using pre-miR397a gene specific primers M: DL2000 marker; 1) pTF101.1-ubi-pre-miR397a; 2, 3, 4) PCR products of positive clones

1. Discussion

miR397a is conserved across several plant species and plays a significant role in plant abiotic stress response and growth and development.  Overexpression of miR397a in Arabidopsis thaliana improved cold tolerance (Dong and Pei, 2014), increased seed size and number (Wang et al.,2014) and tolerance to salt stress (Dong et al., 2013).  In rice it increased yield and number of panicle branches (Zhang et al., 2013).  After overexpression in poplar, Lignin content decreased in the plants (Lu et al., 2013).  In this research, miR397a was expressed differentially under different types of abiotic stress and hormonal treatments implying that it might play a role in abiotic stress tolerance.  Since there is no data on expression pattern analysis of maize miR397a, and no maize plant overexpression, it was imperative to construct an expression vector bearing this gene to elucidate its function.  Overexpression of this gene in maize might show its particular role during abiotic stress response and growth and development.  The mature sequence of miR397a flanked by 226bp upstream and 288 downstream was cloned.  The flanking region was inserted so as to mimic the biogenesis of miR397a and also for protection of the miRNA.  The Zheng58 pre-miR397a sequence showed a 100% homology when compared to B73 sequence.

1. Summary

1. A 143bp pre-miR397a fragment flanked by 226bp upstream and 288bp downstream was amplified by PCR.  The resultant sequence was analyzed by BlastN and showed 100% complementarity with the B73 pre-miR397a sequence from miRBase.
2. An expression vector harbouring the pre-miR397a flanked sequence (pTF101.1-ubi-pre-miR397a) was constructed and transferred to Agrobacterium tumefaciens (EHA101)

4. Cloning and Bioinformatic analysis of Laccase

Laccase plays an important role in abiotic stress tolerance and its functional analysis might show how it contributes to resistance.  Z. mays sp. Zheng 58 was used as research material.  Since the sequence of this species is not known, Z. mays sp. B73 sequence (NCBI Database) was used for primer design for the conserved region.  After the amplification of the conserved part, primers for 3’ and 5’ RACE PCR were designed to amplify a part of 5’ UTR, Open Reading Frame (ORF) and 3’ UTR.  The amplified ORF was digested and cloned into the T-vector and then confirmed by sequencing.  Bioinformatic analysis of the ORF was done so as to figure out sequence homology and phylogeny relationships with other plant laccases.  The ORF was subcloned into the pTF101.1-35s expression vector and transferred to Agrobacterium tumefaciens using the freeze-thaw method before plant transformation.

4.1Experimental materials, laboratory equipment and methods

4.1.1 Plant materials

Inbred lines of Z. mays sp. Zheng 58 were used in this experiment for cloning and characterization.

4.1.2 Laboratory reagents

Trizol (RNAiso) reagent, DNA polymerase (Ex Taq, LA Taq), DL2000 Marker, DNA gel extraction and recovery kit, pMD18 – T carrier and 3 ‘RACE kit (Takara); RNase free water was purchased from Shanghai Sangon biological co., LTD.; SuperScript ™ III reverse transcriptase, 5’ RACE PCR kit (Invitrogen); Anhydrous ethanol, chloroform; Primer synthesis work performed by Invitrogen co., LTD.

4.1.3 Laboratory instruments and equipment

Laminar Air Flow Cabinet(CA-1390-1), Dry Bath, Autoclave (TOMY), NanoDrop 2000c (Thermo Scientific Co., Ltd), Thermo Cycler (TP600) (Takara), Gel imaging system (Phannaeia Biotech Image Master VDS), Electronic Balance (PL303) (Mettler Toledo, Shanghai Co., Ltd), Ultra-Low temperature freezer (SANYO), microwave oven (WP800TL23-K3) (Galanz Co., Ltd, China), Gel Electrophoresis Capillary system (DY-8c).

1. Methodology

4.2.1Total maize RNA extraction

RNA was extracted as described in 2.2.1.

1.       Cloning of the Laccase conserved region

1. Laccase gene conserved region primer design

The Z. mays sp. B73 sequence was used to design Laccase gene primers for the amplification of the conserved region.  The primer sequences are as follows:

ZmLAC-F: 5’-ACGAAGTCCCCGTCTTGTTC-3’

ZmLAC-R: 5’-AGTACAACCTCGTCGACCCCGTCGA-3’

The resultant amplified fragment was predicted to be 1062bp.

1. First strand cDNA synthesis (RT-PCR)

Z. mays sp. Zheng 58 total RNA was used as a template for the following reverse transcription reaction:

dNTP Mixture（10mM）                        1μl

5×ES RT Buffer                                      4μl

Anchored Oligo(dT)18 (0.5μg/μl)         1μl

Ribonuclease Inhibitor（50 units/μl）            0.5μl

EasyScript® RT                                                        1μl

Template RNA                                            5μl (2.5μg of total RNA)

RNase Free H2O                                          up to 20μl

Thermo cycler reaction conditions: 42℃       30min

85℃          5s

Amplification of the Laccase conserved region

With cDNA as a template, ZmLAC-F and ZmLAC-R primers were used to amplify a part of the

Laccase gene coding region (conserved region).  The PCR amplification reaction was as

Follows:

10×PCR Buffer                                                        5μl

dNTP Mixture                                                        4μl

CS-F（10μM）                                          1μl

CS-R（10μM）                                          1μl

LA Taq (5U/L)                                                     0.5μl

cDNA                                                                       5μl

ddH2O                                                        up to 50μl

Thermo cycler reaction conditions:  94℃（5min）  1

                                                                                              94℃（30s）

58℃（30s）

35

72℃（1min）

72℃（10min）  1

16℃  ∞

1. Agarose Gel DNA Extraction

After amplification of the conserved region, the PCR product was ran on a 1% agarose gel.  The expected band was extracted and purified using the MiniBEST Agarose Gel DNA Extraction Kit.  The following protocol was followed:

1) The amplicon 1062bp gel band was excised under UV light prior to net weight measurement.

2) Gel was dissolved in Buffer GM by gently shaking

3) DNA was bound to a spin column/matrix by centrifugation and the supernatant was thrown away

4) DNA was washed by Buffer WB and centrifuged twice

5) The spin column was put in a new 1.5ml centrifuge tube and left to dry.

6) 30ml of DEPC water was added to the spin column to elute the DNA

1. T-vector cloning

Cloning of DNA into pMD18-T cloning vector protocol is as follows:

pMD18-T vector	1μL
DNA fragment（50ng/L）	2μL
Solution I	5μL
ddH2O	2μL

Reaction conditions: 16℃ for 5h

1. Transformation of E. coli cells

1. Take DH5α competent cells out of -80°C and thaw on ice (approximately 20-30 mins).

1. Remove agar plates (containing Ampicillin) from storage at 4°C and allow to warm up to room temperature.

1. Mix 5 μl of DNA (usually 10 pg – 100 ng) into 20-50 μl of competent cells in 1.5ml centrifuge tube. GENTLY mix by flicking the bottom of the tube with your finger a few times.

1. Incubate the competent cell/DNA mixture on ice for 30 mins.

1. Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 90 secs.
2. Put the tubes back on ice for 2 min.
3. Add 1ml LB to the bacteria and grow in 37°C shaking incubator for 60 min shaking at 180rpm.
4. Plate 200µl onto LB agar plate containing 100µg/ml and incubate plates at 37°C overnight.

Positive clone screening of Bacterial clones

1. Pick E. coli single colonies from the petri dish and place them in a centrifuge tube with LB medium supplemented by Ampicillin.  Shake the centrifuge tube at 180rpm for 5hours.
2. Transfer 200µl from to a new centrifuge tube and centrifuge at 10000rpm for 1min.  Discard supernatant.
3. Add 30µl of sterile ddH2O to the centrifuge tube and place it in a dry bath at 98°C for 15mins.
4. Centrifuge at 10000rpm for 1min.  Pipette 2µl and use it as a PCR template.

The PCR reaction is as follows:

10×PCR Buffer	2 μl
dNTP Mixture	2 μl
ZmLAC-F (10μΜ)	1μl
ZmLAC-R (10μΜ)	1μl
Ex Taq（5U/L）	0.2μl
PCR template(supernatant)	2μl
ddH2O	up to 20μl

Thermo cycler reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）			35cycles
72℃（10min）		1
16℃		∞

PCR results were detected and analyzed on `1% agarose gel electrophoresis.

Sequencing and analysis of the Zm-LAC partial coding region.

Positive clones were submitted to Invitrogen Co. Ltd for sequencing.  The resultant sequences were then analyzed by NCBI blastn in comparison with the already available B73 sequence.

1.       Cloning of the Laccase gene 3’ end with 3’ RACE PCR

1. 3’ RACE PCR primer design

Using the Laccase gene partial coding region sequence results, two 3’ RACE PCR primers were designed (3’ GSP1 and 3’ GSP2).  In addition to these primers, a screening primer (3’-994) was also designed to confirm the 3’ RACE PCR procedure and results.  The primer sequences are as follows:

ZmLAC 3’GSP1:  5′-GCACAGGCGGTTCTTCTTCACGGTC-3′

ZmLAC 3’GSP2:  5′-CGTGAACAACGTCTCCTTCGTGCTC-3′

ZmLAC 3’-994:  5′-GAAGAAGTTGAAGCCGTGGAGGTGC-3′

1. 3’ RACE PCR

Total Z.mays RNA isolation

See RNA extraction method 1.2.1.

First-Strand cDNA Synthesis of 3′-RACE

Following the Takara Co Ltd manufacturer’s instruction, the 3’ RACE PCR below was followed:

RNA(500ng/μl)	2μl
PrimeScript RTase（200 U/μl ）	0.25μl
RNase Inhibitor	0.25μl
dNTP Mixture（10mM each）	1μl
3′ RACE Adaptor(5 μM )	1μl
5× PrimeScript Buffer	2 μl
RNase Free dH2O	up to 20μl

Thermocycler conditions:             42°C   60min

70°C   15min

Nested PCR

1. Outer PCR procedure is as follows:

Mixture from	5μl
LA Taq（5U/μl）	0.25μl
10×LA PCR Buffer	5μl
1×cDNA Dilution Buffer II	5μl
3 GSP1 (10μM)	2μl
3′ RACE Outer Primer(10μM)	2μl
ddH2O	30.75μl
Total volume	50μl

Thermocycler conditions:

94℃（3min）	1
94℃（30s）   55℃（30s） 72℃（2min）			35 cycles
72℃（10min）		1
16℃		∞

1. Inner PCR procedure is as follows:

1st PCR product	1μl
LA Taq（5U/μl）	0.5μl
10×LA PCR Buffer	5μl
3GSP2 (10μM)	2μl
3′ RACE Inner Primer (10μM)	2μl
dNTP Mixture (2.5 mM each)	8μl
ddH2O	Up to 50μl

Thermocycler conditions:

94℃（5min）		1
94℃（30s）   55℃（30s） 72℃（1min）		35 cycles
72℃（10min）		1
16℃		∞

1. 3’ RACE PCR product extraction and sequencing vector construction

3’ RACE PCR products were run on a 1% Agarose Gel Electrophoresis.  The band size……. Was cut and purified following the manufacturer’s instruction (Takara Co. Ltd MiniBEST Agarose Gel DNA Extraction Kit).  The protocol is described in 2.2.2.

3’ RACE PCR product and T-Vector construction

The purification of 3’ RACE PCR products and cloning them into the pMD18-T cloning vector

protocol is as follows:

Solution I	5μl
3’RACE PCR product（50ng/μl）	2μl
T-vector	1μl
dH2O	2μl
Total Volume	10μl

Dry Bath conditions: 16°C   5hours

E. coli cell transformation

As described in 2.2.2.

The screening of positive clones

1. PCR Screening of Bacterial clone

Pick E. coli single colonies from the petri dish and place them in a centrifuge tube with LB medium supplemented by Ampicillin.  Shake the centrifuge tube at 180rpm for 5hours.  PCR Screening of Bacterial clones is done following the protocol mentioned in 2.2.2.

The PCR reaction is as follows:

Bacterial clone template	2μl
Ex Taq（5U/μl）	0.5μl
10×Ex PCR Buffer	2μl
3GSP2 (10μM)	1μl
ZmLAC 3’-994 (10μM)	11μl
dNTP Mixture（2.5 mM each）	2μl
ddH2O	Up to 20μl

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   55℃（30s） 72℃（30s）		35
72℃（10min）		1
16℃		∞

1. Zm-LAC gene sequencing and analysis

Positive clones were submitted to Invitrogen Co. Ltd for sequencing.  The resultant sequences were then analyzed by NCBI blastn in comparison with the already available B73 sequence.

1. Cloning of the Laccase gene 5’ end with 5’ RACE PCR

In this study cloning of the Laccase 5 ‘end was by 5’ RACE PCR method. The Laccase conservative region was used as a template to design three nested primers. Total maize leaf RNA was isolated and reverse transcribed to cDNA which was used for subsequent experiments.  5’ GSP0 was used for PCR amplification, products were recycled and purified by terminal transferase. The resultant PCR product was used as a template for two rounds of PCR with 5’GSP1 and 5’GSP2. The final PCR product was ran on a gel, extracted and purified before inserting it in a sequencing vector.  E. coli cells were transformed, screened and sent for sequencing.

(1) 5’ RACE PCR Primer design

Using the Laccase gene partial coding region sequence results, three 5’ RACE    PCR     primers were designed (5’ GSP1, 5’ GSP2 and 5’ GSP3).  In addition to these primers, a screening primer (5’-13) was also designed to confirm the 5’ RACE PCR procedure and results.  The primer sequences are as follows:

ZmLAC 5’GSP0:  5’-GCCAGCATGTAGTAGGTG-3′

ZmLAC 5’GSP1:  5’-GGTAGGACGGCTTGGTGGTGAGGAG-3′

ZmLAC 5’GSP2:  5’-CCACGGTGATGGGCTTGATGTAGAC-3′

ZmLAC 5’-13:  5′-TCTTGTTCGGGGAGTGGTGGACGGC-3′

Oligo(dC)18: 5′-CCCCCCCCCCCCCCCCCC-3′

(2) 5’ RACE PCR

Total Z.mays RNA isolation

See RNA extraction method 1.2.1.

First-Strand cDNA Synthesis of 5′-RACE PCR

5’ RACE PCR below was as follows:

dNTP Mixture（10mM）	1μl
5×ES RT Buffer	4μl
Oligo(dT)18 (0.5μg/μl)	1μl
Ribonuclease Inhibitor（50 units/μl）	0.5μl
EasyScript® RT	1μl
Template RNA	5μl (2.5μg)
RNase Free H2O   Reaction conditions:  42 ℃    30min                       85 ℃      5sec	up to 20μl

Single primer amplification reaction

cDNA template	1μl
dNTP Mixture(2.5mM each)	2μl
10×LA PCR Buffer	2μl
5’GSP0 (10μM)	1μl
LA Taq（5U/µl）	0.2μl
ddH2O	13.8μl
Total volume	20μl

Reaction conditions:
94℃（3min）	1
94℃（30s）   55℃（30s） 72℃（1min30s）		35
72℃（10min）	1
16℃	∞

TdT Tailing of cDNA

5×TdT Buffer	4μl
0.1%BSA	2μl
dGTP(10mM)	1μl
TdT	0.5μl
Single primer amplification products	12.5μl
Total volume	20μl

Reaction conditions: 37°C          3hrs

Nested PCR amplification

Single primer amplification products	1μl
dNTP Mixture(2.5mM each)	5μl
10×LA PCR Buffer	5μl
5GSP1/5GSP2 (10μM)	2μl
Oligo(dC)18 (10μM)	2μl
LA Taq(5U/µL)	0.5μl
Total volume	50μl

Reaction conditions:
94℃（3min）	1
94℃（30s）   55℃（30s） 72℃（1min30s）		35
72℃（10min）	1
16℃	∞

The amplified fragment was analyzed using 1% agarose gel electrophoresis before extraction and purification.

T-vector construction

Solution I	5μl
Amplified cDNA fragment（50ng/μl）	2μl
T-vector	1μl
ddH2O	2μl
Total Volume	10μl

Reaction conditions: 16°C   Overnight.

The T-vector containing the cDNA fragment will be used to transform E. coli cells.

Positive clone screening

Pick E. coli single colonies from the petri dish and place them in a centrifuge tube with LB medium supplemented by Ampicillin.  Shake the centrifuge tube at 180rpm for 5hours.  PCR Screening of Bacterial clones is done following the protocol mentioned in 2.2.2.

10×PCR Buffer	2μl
dNTP Mixture(2.5mM each)	2μl
5GSP2 (10μM)	1μl
Zm-LAC 5’-13 (10μM)	1μl
EX Taq（5U/μl）	0.2μl
Bacterial clone template	5μl
Total volume	20μl

Reaction conditions:
94℃（5min）		1
94℃（30s）   55℃（30s） 72℃（30s）			35
72℃（10min）		1
16℃		∞

Products were ran on 1% agarose gel electrophoresis for analysis and the positive clones were sent for sequencing.  The resultant sequence was analyzed by BlastN in the NCBI database.

4.2.5     Zm-LAC gene ORF cloning

After obtaining the conserved region, 3’ end and 5’ end sequences of the Laccase gene, NCBI tool, ORF finder, was used to determine the coding sequence (CDS).  Laccase was predicted to be the target gene of miR397a in Zea mays.  The two sequences were analyzed by BlastN so as to determine the position of the binding site.  The miR397a binding site was observed to be in the ORF of the Laccase gene sequence.  Therefore, when constructing the plant expression vector, the ORF should be included so as to study the miR397a-Laccase interaction.  Primers with restriction enzyme sites (BamI and SpeI) were designed for the amplification of the ORF. RNA was isolated prior to reverse transcription and PCR amplification of the coding sequence.

1. ORF Primer design

Primers were designed using Premier primer 5.0 software and the sequences are as follows:

LAC-ORF-5’-BamHI

5’ CGCGGATCCATGGCTACCCCCTACCGTCTTCCTT  3′

LAC-ORF-3’-SpeI

5’ GGACTAGTCTAACATTTGGGCAGATCCGATGGC  3′

1. Total maize RNA isolation

RNA was isolated following the procedure in 2.2.2.

1. Complete ORF sequence amplification

RNA was reverse transcribed to cDNA following the EasyScript ® Reverse Transcriptase Reverse transcription manual.  The reaction method is described in 2.2.2.

PrimeStar Max	10 μl
LAC-ORF-5’-BamHI	1μl
LAC-ORF-3’-SpeI	1μl
cDNA template	1μl
ddH2O	up to 20μl

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（40s） 72℃（1min30s）
		35
72℃（10min）		1
16℃		∞

The PCR product was ran on a 1% agarose gel electrophoresis prior to extraction and purification.

PCR product extraction and purification

Gel DNA extraction was done using MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 DNA (Takara Co. Ltd) following the protocol described in 2.2.1.

T-vector construction

The following procedure was used for T-vector construction:

pMD18-T vector	1μl
DNA fragment（50ng/l）	2μl
Solution I	5μl
ddH2O	2μl
Reaction conditions: 16℃      5h

E. coli cell transformation

Competent cell transformation was carried out following the procedure described in 3.2.1.

Positive clone screening

Pick E. coli single colonies from the petri dish and place them in a centrifuge tube with LB medium supplemented by Ampicillin.  Shake the centrifuge tube at 180rpm for 5hours.  PCR Screening of Bacterial clones is done following the protocol mentioned in 2.2.2.

The PCR reaction is as follows:

10×PCR Buffer	2 μl
dNTP Mixture	2 μl
LAC-F (10μΜ)	1μl
LAC-R (10μΜ)	1μl
Ex Taq（5U/l）	0.2μl
Bacterial clone template	2μl
ddH2O	up to 20μl

Reaction conditions:
94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）			35
72℃（10min）		1
16℃		∞

Products were ran on 1% agarose gel electrophoresis for analysis and the positive clones were sent for sequencing.  The resultant sequence was analyzed by BlastN in the NCBI database.

4.2.6 Laccase gene sequence Bioinformatic analysis

(1) Open reading frame (ORF) and amino acid sequence prediction

NCBI tool, ORF finder, was used to determine the coding sequence (CDS) of the Laccase gene.  The sequence was translated to amino acid using an online gene tool.

(2) Zm-LAC amino acid conserved region analysis

ClustalX software was used for sequence alignment of Zm-LAC and other Laccases from various species.  This was done to analyse the different conserved regions that constitute a typical Laccase family member.

(3) Zm-LAC amino acid sequence homology comparison

Analysis of the amino acid homology between Zm-LAC and other Laccases from different species was carried out using NCBI BLASTp analysis tool

(4) Evolutionary analysis

Using the ClustalX and MEGA4.0 softwares, a phylogenetic tree was constructed to analyze the evolutionary relationship amoung various Laccases.

1.       Plant expression vector construction

1. Tobacco expression vector construction

Coding region primer sequences:

LAC-ORF-5’-BamHI

5’ CGCGGATCCATGGCTACCCCCTACCGTCTTCCTT  3′

LAC-ORF-3’-SpeI

5’ GGACTAGTCTAACATTTGGGCAGATCCGATGGC  3′

PCR was carried out using the pair of primers to amplify the ORF region of the cDNA.

1)Plasmid propagation

E. coli cells containing pTF101-35s expression vector was taken from the -80℃ cryogenic      freezer.  It was allowed to thaw on ice and thereafter plated on solid LB medium supplemented by Spectinomycin.   It was incubated at 37℃ overnight.  A single colony was picked and put in liquid LB medium supplemented by Spectinomycin.  It was incubated on a 37℃ shaking bed at 180rpm for 12 to 16h.

2) pTF101-35s plasmid extraction

a).  Transfer 1.4-5 mL of bacterial cultures to a sterile microcentrifuge tubes.

Mix each culture well before taking the cells. Many cells will have sunk to the  

                  bottom of the tube.

           b).  Centrifuge for 2min at 8000g.

                          c).  Resuspend the pelleted bacterial cells in 250 μl of Buffer P1.

d).  Add 250 μl of Buffer P2. This is the alkaline SDS solution for cell lysis.

Invert the tube immediately (and gently) 10 times.  DO NOT VORTEX!

e).  Add 350 μl of Buffer P3 and mix by inverting several times.

f).  Centrifuge for 10 minutes at 12000g.  A white pellet will form.

g).  Discard the supernatant and centrifuge for 30s at 8000g.  Discard the supernatant.

h).  Add 500µl Wash solution and centrifuge at 9000g for 30s.

i).  Discard the flow-through, and centrifuge for an additional 1 min to remove

residual Wash solution.

j).   Place the column in a clean 1.5ml microcentrifuge tube.  To elute DNA, add 50 μl

water to the center of each column, let it stand for 1 min, and then centrifuge for 1

min. 1% agarose gel electrophoresis is used to detect quality of plasmid.

 

3) Plasmid restriction enzyme digestion

Two restriction enzymes (BamHI and SpeI) were used to cut the pTF101-35s plasmid.    The reaction was as follows:

pTF101-35s（500ng/μl）	10μl
10×T buffer	10μl
BamHI	5 μl
SpeI	5 μl
0.1%BSA	10μl
ddH2O	up to 100μl

Enzyme reaction conditions:  37°C    6h

1% Agarose Gel electrophoresis was used for the detection of enzyme products.  MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0 DNA recovery Kit was used for gel extraction and purification following the protocol described at 3.2.2.

1.  Tobacco expression vector pTF101-35s – Zm-LAC

After extraction and purification of linearization vector and Zm-LAC genes, they need to be ligated so as to make a recombinant vector.  The ligation reaction is as follows:

2×Assembly Mix	5μl55μL
PTF101-35svector（100ng/μl）	2μl
Zma-LAC Insert（100ng/μl）	0.5μl
ddH2O	2.5μl

Ligation reaction conditions: 50℃  15min

After this reaction, the recombinant vector is used to transform E. coli competent cells following the protocol as explained in 3.2.2.  PCR is done for positive clone screening using the protocol on 3.2.2.  1% Agarose gel electrophoresis was used to analyse the PCR products and positive bacterial clones were sent for sequences.

5) Recombinant plasmid extraction

E. coli cells harbouring the recombinant expression vector were grown in LB liquid media at 180rpm for 12h.  The recombinant plasmid was extracted following the protocol on 3.2.3.

6) Agrobacterium tumefaciens preparation

a. Agrobacterium tumefaciens EHA101 is taken from -80 ℃ ultra-low temperature freezer and grown on solid YEP media supplemented by 50 mg/l kanamycin and 5 mg/l rifampicin in 28℃ for 48h.

b. Pick a single colonies of bacteria and grow them in liquid YEP medium supplemented by kanamycin and rifampicin at 180rpm in 28℃ overnight.

c. The bacteria is transferred to liquid YEP media without antibiotics at the ratio of 1:100.  The Bacterial solution is shaken at 180rpm in 28℃ until it reaches OD600 0.3-0.5.

d. The above microbial solution is placed on ice for 30 min and centrifuged at 4000rpm in 4℃ for 10mins.  Discard the supernatant.

e. Add 4 ml of 20mM CaCl2 solution to the pellet and centrifuge.  Discard the supernatant.

f. Add 1ml ice cold 20mM CaCl2 solution to the pellet, add 50% glycerol to 1.5 ml of centrifuge tube.  Resuspend cells in this mixture and transfer to the cryogenic refrigerator for later use.

7) Transformation of A. tumefaciens with plasmid DNA

a. Add 1-2µg of plasmid DNA to one tube containing Agrobacterium cells.  Mix by tapping with your finger gently.

b. Freeze tubes in liquid Nitrogen for 1min, then thaw tubes for 5 min @ 37°C.

c. Add 1ml of YEP liquid medium and shake at 180rpm for 4-5h in 28°C.

d. Centrifuge the bacterial solution and discard 200µl of the supernatant.  The remaining solution should be suspended in the tube.  200µl is spread plated on a petri-dish containing solid YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin and grown for 36h in 28°C.

e. Pick a single colony and suspend in 1ml YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin at 180rpm in 28°C overnight.

8) Positive clone screening

Pipette 200µl of bacterial solution and centrifuge at 12000rpm for 1min.  Discard

supernatant and add 30µl DEPC water.  Place in liquid Nitrogen for 10mins and then transfer to a 98°C dry bath for 5min.  Repeat this process again.  PCR is done using bar gene primers and Zma-LAC primers.

Take 200µl of the bacterial culture and centrifuge at 12000rpm for 1min. Discard supernatant and add 30µl DEPC water.  Place the bacterial suspension in liquid Nitrogen for 10min and transfer to a 98℃ dry bath for 5min.  Repeat this procedure and proceed to PCR.  PCR for positive clones is done using Bar-F, Bar-R primers and the Zma-LAC gene primers (Zma-LAC-F and Zma-LAC-R). Positive clones were transferred to a 1.5ml tube and suspended in glycerol (1:1) and stored in a cryogenic freezer for later use.

(2) Maize expression vector construction

The restriction enzyme digested expression vector (pTF101.1-ubi) is ligated to the Zma-LAC (containing the restriction enzyme sequences on both ends).  The resultant fragment was isolated, purified and recovered from agarose gel electrophoresis by Gel Extraction kit.  The recombinant plasmid (pTF101.1-ubi-Zma-LAC) was verified by sequencing.

1) Recombinant plasmid extraction

E. coli cells harbouring the recombinant expression vector were grown in LB liquid media at 180rpm for 12h.  The recombinant plasmid was extracted following the protocol on 3.2.3.

2) Agrobacterium tumefaciens preparation

a. Agrobacterium tumefaciens EHA101 is taken from -80 ℃ ultra-low temperature freezer and grown on solid YEP media supplemented by 50 mg/l kanamycin and 5 mg/l rifampicin in 28℃ for 48h.

b. Pick a single colonies of bacteria and grow them in liquid YEP medium supplemented by kanamycin and rifampicin at 180rpm in 28℃ overnight.

c. The bacteria is transferred to liquid YEP media without antibiotics at the ratio of 1:100.  The Bacterial solution is shaken at 180rpm in 28℃ until it reaches OD600 0.3-0.5.

d. The above microbial solution is placed on ice for 30 min and centrifuged at 4000rpm in 4℃ for 10mins.  Discard the supernatant.

e. Add 4 ml of 20mM CaCl2 solution to the pellet and centrifuge.  Discard the supernatant.

f. Add 1ml ice cold 20mM CaCl2 solution to the pellet, add 50% glycerol to 1.5 ml of centrifuge tube.  Resuspend cells in this mixture and transfer to the cryogenic refrigerator for later use.

3) Transformation of A. tumefaciens with plasmid DNA

a. Add 1-2µg of plasmid DNA to one tube containing Agrobacterium cells.  Mix by tapping with your finger gently.

b. Freeze tubes in liquid Nitrogen for 1min, then thaw tubes for 5 min @ 37°C.

c. Add 1ml of YEP liquid medium and shake at 180rpm for 4-5h in 28°C.

d. Centrifuge the bacterial solution and discard 200µl of the supernatant.  The remaining solution should be suspended in the tube.  200µl is spread plated on a petri-dish containing solid YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin and grown for 36h in 28°C.

e. Pick a single colony and suspend in 1ml YEP supplemented by 50mg/l Kanamycin, 100mg/l Spectinomycin and 50mg/l Rifampicin at 180rpm in 28°C overnight.

4) Positive clone screening

Pipette 200µl of bacterial solution and centrifuge at 12000rpm for 1min.  Discard

supernatant and add 30µl DEPC water.  Place in liquid Nitrogen for 10mins and then transfer to a 98°C dry bath for 5min.  Repeat this process again.  PCR is done using bar gene primers and zma-pre-miR397a primers.

4.3 Results and analysis

4.3.1 Cloning of Laccase gene conserved region

RNA was extracted from maize leaves and RT-PCR was done to synthesize cDNA.  Forward and reverse primers were designed using Premier Primer 5 software from a NCBI B73 maize Laccase sequence.  Using PCR a 1062bp Laccase fragment was amplified Fig 4.1a.  The cloned fragment was inserted in a sequencing vector pMD18-T and was used to transform E. coli cells by the freeze-thaw method.  Positive clones were detected by PCR using two pairs of Laccase gene-specific primers Fig 4.1b and c.  The resultant 1062bp sequence was run using BLASTN and it showed 99% sequence similarity.

Fig 4.1: Agarose gel electrophoresis for the PCR product of the Zma-Laccase partial coding region and positive clone screening

a) M) DL2000 DNA Marker; 1) PCR product of the partial coding region of Laccase (1062bp)

b) M) DL2000 DNA Marker; 1-4) PCR products of transformed E. coli cells using Laccase gene specific     primer 1 (345bp)

c) M) DL2000 DNA Marker; 1-4) PCR products of transformed E. coli cells using Laccase gene specific primers 2 (216bp)

4.3.2 Laccase gene 3’ end cloning

To identify the 3’ end of the Laccase gene, 3’ RACE (Rapid Amplification of cDNA ends) PCR specific primers were designed (3’ GSP1, 3’GSP2 and 3’ 994) from the Z. mays B73 Laccase sequence. The first round of PCR (Nested PCR) involved the 3’ GSP1 and 3’ RACE Outer primer using cDNA as a template.  Nested PCR products were used as templates in the second round of PCR (Inner PCR) involving 3’ GSP2 and 3’ RACE Inner primers.   A 709bp fragment was amplified (Fig 4.2a).  The fragment was inserted in a cloning vector (pMD18T).  This was used to transform E. coli cells by the freeze-thaw method.  E. coli cells were allowed to grow and single colonies were picked for screening.  PCR screening using two Laccase gene-specific primers confirmed that the gene was inserted in the vector.  The fragment was sent for sequencing.  The resultant sequences were analyzed by BlastN homology comparison with Z. mays B73 Laccase sequence.  99% sequence similarity to the 3’ end was observed in the results.

Fig 4.2: Identification of the Laccase 3’end

a) Agarose gel electrophoresis of the 3’ RACE PCR product (709bp)

b) PCR positive clone detection using Laccase gene specific primer 1.M: DL2000 marker; 1-4: transformed E. coli cells

(406bp)

c) PCR positive clone detection using Laccase gene specific primer 2. M: DL2000 marker; 1-4: transformed E. coli cells(316bp)

The arrows in the figure mark the band size of the PCR product

4.3.3 Laccase 5’ end cloning

From the partial coding sequence, four 5’ RACE PCR specific primers were designed for the amplification of the 5’ end.  Total RNA was isolated and transcribed to cDNA using 5’ GSP1.  The cDNA was snap column purified and dC-tailed.  PCR of dC-tailed cDNA by 5’ GSP2 and the Abridged anchor primer followed.  To obtain the final product, Nested amplification was done using the Universal Adaptive Primer and the nested 5’ GSP3.  The final product of this amplification was 926bp (Fig 4.3a). The fragment was inserted in the sequencing vector pMD18-T. E. coli cells were transformed by the construct.  The resultant positive clones were verified using two Laccase gene-specific primers (Fig 4.3b and c) and sequenced.  After sequencing, a BLASTN analysis was run and a 99% sequence similarity was observed.

a

b

c

Fig 4.3: Identification of the Laccase 5’end

a) Agarose gel electrophoresis of the 5’ RACE PCR product

b) PCR positive clone detection using Laccase gene-specific primer1 M: DL2000 marker; 1-4: transformed E. coli cells (202bp)

c) PCR positive clone detection using Laccase gene specific primer 2.M: DL2000 marker; 1-4: transformed E. coli cells (698bp)

The arrows in the figure mark the band size of the PCR product

4.3.4 Z. mays Laccase coding region determination

With the resultant cloning of the conserved region, 3’ end and 5’ end, the three sets of sequences were analyzed using the ORF finder to predict the Open Reading Frame (ORF).  Primers were used to amplify the ORF and the resultant fragment (1749bp) (Fig 4.4) was inserted in a sequencing vector and used to transform E. coli cells.  The single colonies were screened and positive clones were sent for sequencing.  The sequences were analyzed by NCBI BlastN homology comparison and showed 99% similarity.

          M            1

Fig 4.4: The ORF PCR product of Zma-Laccase gene

M) DL 2000 marker; 1) PCR product of the Laccase gene ORF(1749bp)

4.3.5 Bioinformatic analysis of Laccase

ORF determination and analysis

After sequencing, the full length ORF of Laccase was obtained.  The partial 5’ UTR end length was 37bp, ORF 1749bp and 3’ UTR (Untranslated region) 335bp as shown below Fig 4.5.

GCTTAGCCTTGCTTTCTTCGTTGTAGGAACTGCAACAATGGCTACCCCCTACCGTCTTCCTTGCTGCTGCTATGCCCTCGTCACTGTGCTCGTGCTCTTCTTCTCCGTCGACGCTACGGAGGGCGCCATCAGGGAGTACCAGTTCGATGTGCAAATGACCAATGTGACGCGGCTGTGCAGCAGCAAGAGCATCGTGACGGTGAACGGCCAGTTCCCGGGGCCGACGGTGTTCGCGAGGGAGGGCGACTTCGTCGTCATCCGCGTCGTCAACCACGTCCCCTACAACATGAGCATCCACTGGCACGGCATCCGGCAGCTGCGGAGCGGGTGGGCGGACGGGCCGGCGTACATCACGCAGTGCCCGATCCAGAGCGGCCAGAGCTACGTGTACAAGTTCACCATCACGGGGCAGCGCGGCACGCTGTGGTGGCACGCGCACATCTCCTGGCTGCGCGCCACCGTCTACGGGCCCATCGTCATCCTGCCCAAGCCCGGCGTCCCTTACCCGTTCCCGGCGCCCTACGACGAAGTCCCCGTCTTGTTCGGGGAGTGGTGGACGGCCGACACGGAGGCGGTGATCAGCCAGGCGCTCCAGACCGGCGGAGGCCCCAACGTCTCCGACGCCTTCACCATCAACGGGCTGCCTGGGCCGCTCTACAACTGCTCTGCAAAAGACACGTTCAAGCTGAAAGTGAAGCCCGGGAAGACGTACATGCTCCGCATCATCAACGCTGCGCTCAATGACGAGCTCTTCTTCTCCATCGCCGGCCACCCGCTCACCGTCGTTGACGTCGACGCGGTCTACATCAAGCCCATCACCGTGGAGACCATCATTATCACCCCTGGGCAGACCACCAACGTGCTCCTCACCACCAAGCCGTCCTACCCTGGCGCCACCTACTACATGCTGGCTGCGCCCTACTCCACCGCCAGGCCGGGCACCTTCGACAACACCACCGTCGCCGGCATCCTCGAGTACGAGGACCCCACGTCGTCCCCTCCCCCGCACGCGGCCTTCGACAAGAACCTCCCGGCGCTGAAGCCGACCCTGCCGCAGATCAACGACACGAGCTTCGTCGCCAACTACACGGCCAGGCTCCGCAGCCTGGCCACCGCGGAGTACCCGGCCGACGTGCCGCGGGAGGTGCACAGGCGGTTCTTCTTCACGGTCGGGCTGGGCACCCACCCGTGCGCCGTGAACGGGACGTGCCAGGGCCCCACCAACAGCAGCCGGTTCGCGGCGTCCGTGAACAACGTCTCCTTCGTGCTCCCCACCACGGCGCTGCTGCAGTCGCACTTCGCCGGCAAGTCCAGGGGGGTGTACTCGTCCAACTTCCCGGCCGCGCCGCTGGTCCCGTTCAACTACACGGGGACGCCGCCCAACAACACCAACGTGTCCAACGGCACCAAGCTGGTGGTGCTGCCGTACGGCACCAGCGTGGAGCTGGTGATGCAGGGCACCAGCATCCTCGGCGCCGAGAGCCACCCGCTGCACCTCCACGGCTTCAACTTCTTCGTCGTCGGCCAAGGGTTCGGCAACTTCGACCCCGCCAAGGACCCGGCCAAGTACAACCTCGTCGACCCCGTCGAGCGTAACACCGTCGGCGTGCCGGCGGCCGGGTGGGTGGCCATCCGGTTCCGCGCAGACAATCCAGGGGTGTGGTTCATGCATTGCCACTTGGAAGTTCACGTCAGCTGGGGCCTGAAAATGGCATGGCTGGTGCTGGACGGAGACCGCCCCAACGAGAAGCTACTGCCTCCGCCATCGGATCTGCCCAAATGTTAGACGACACGAGGAATTGCTGGCCTAGTCGTCGCCATCAACGGCCGTGATTGATCGGCCCGGACCATCTTGGAACAGGGATTGCCGTGCTCTCTAATTTGCACAGGATATCTTACCGTCTTTTGCTTGTGCTGGGGTTGGTGTTATGCTTCCATTTAGTGGTGTGCTTTTTCCGGTTTGAGTCGTCGTCTGGTTAGCTGTGTGAGAGACACGGGCAGGAAGGTCCGTTGATGGTACTAGACAGACGCCATTTTTTTTTATTATACTTTGAGTTACTACCATCTTTTGTACTGCCTCAGTCCTAAAATAATTGACATTCTTGTTTTTAAAAAAAAAAAAAAAAA
Fig 4.5: Zma-Laccase gene cDNA sequence

Partial 5’UTR Dark-grey background, start (ATG) and stop codon (TAG) (bold letters), and 3’UTR (white)

Amino acid Sequence analysis

The amino acid sequence (583aa) (Fig 4.6) showed all features and characteristics of a typical Laccase gene such as four highly conserved ligands of copper, multi-copper oxidase signature, Proline-rich domain, putative N-glycosylation sites and a signal peptide sequence Fig 4.7.

Fig 4.6. Laccase gene deduced amino acid sequence

Fig 4.7: Analysis of the Laccase amino acid sequence using ClustalW

Alignment of the deduced amino acid sequence of Zma-Laccase with the amino acid sequences of Laccases from other species.     This Clustal alignment shows the features of Laccases such as a putative signal peptide 1, N-glycosylation sites 2, highly conserved copper ligands 3, highly conserved regions 4, and Proline-rich domain 5.

Amino acid homology analysis

NCBI GenBank and BLAST tools were used to analyse the Laccase gene amino acid homology comparison to other species. Results of the analysis showed that Arabidopsis thaliana (LAC17) had the highest sequence homology (76%) followed by rice laccase (Oryza sativa) and the similarity decreased down to Arabidopsis thaliana (LAC11) which had a sequence similarity of 51%(Table. 4.1).

Table 4.1 ZmLAC amino acid sequence homology analysis

Gene name	Species	Identity
AtLAC17	Arabidopsis thaliana	76%
OsLAC13	Oryza sativa J.	72%
SiLAC	Setaria italic	68%
BdLAC	Brachypodium distachyon	68%
ZmLAC4	Zea mays	65%
AtLAC2	Arabidopsis thaliana	62%
ZmLAC2	Zea mays	60%
ZmLAC5	Zea mays	58%
AtLAC4	Arabidopsis thaliana	52%
AtLAC11	Arabidopsis thaliana	51%

Phylogenetic analysis of Laccase gene

For sequence alignment analysis, Laccase sequences of other plants which showed high similarity to Zma-Laccase were retrieved from GenBank based on a BlastP analysis (http://ncbi.nih.gov).  The protein sequences, starting from the first Methionine (M), were used in the alignment.  A Phylogenetic tree was constructed based on the Clustal protein alignment analysis Fig 13.  The results showed a close evolutionary relationship amoung the Zma-Laccase  and other plant Laccases such as Rice Laccase 13, zma-LAC4, Ath-LAC17, Ath-LAC2, Zma-LAC2, Zma-LAC5. 

Fig 4.8: Phylogenetic tree of Laccase with selected Laccases from various plant species

(Phylogenetic tree was generated based on ClustalW and MEGA5.0) Zm (Zea mays); Ath(Arabidopsis thaliana). Alignment is based on the amino acid sequences.

4.3.6 Plant expression vector construction

Tobacco expression vector construction

After sequencing, the amplified Zma-Laccase ORF sequence fragments (Fig 4.9a) were cloned in the restriction enzyme sites of expression vector pTF101.1 driven by the 35s promoter (Fig 4.9b).  E. coli cells were transformed by the plasmid and positive clones were detected by PCR using bar gene primers and Laccase gene-specific primers. A 1749bp cDNA fragment of the Zma-Laccase that corresponds to the ORF was used for the construction of the pTF101.1-35s-LAC expression vector (Fig 4.9c).

(c)

Fig 4.9: Plant Expression vector construction

Agarose gel electrophoresis of a) Laccase ORF sequence PCR product

b) M) λ-EcoT14 I digest marker, 1) pTF101.1-35s plasmid digested by restriction endonucleases

c) Schematic structure of the recombinant pTF101.1-35s-LAC construct

Transformation of A. tumefaciens with plasmid DNA (pTF101-35s-LAC)

The recombinant construct was transferred from E. coli cells to Agrobacterium tumefaciens EHA101.  Transformation of A. tumefaciens with pTF101.1-35s-LAC vector was done using the freeze-thaw method.  Positive clone detection was done by PCR using bar gene primers and Zma-Laccase gene specific primers (Fig 4.10a and b).

Fig 4.10: Agarose gel electrophoresis of transformed A. tumefaciens cells

a) PCR detection of transformed A. tumefaciens using bar gene primers M: DL2000 marker; 1-4) PCR products of positive clones

b) PCR detection of transformed A. tumefaciens cells using Laccase gene specific primers M: DL2000 marker; 1-4) PCR products of positive clones

Maize expression vector construction

The ORF cDNA fragment of the maize Laccase (Fig 4.11a) was used for the construction of pTF101.1-ubi-LAC construct (Fig 4.11b and c).  Recombinant expression vector sequence detection was done by PCR using bar gene primers and Laccase internal primers.

Fig 4.11: Plant Expression vector construction

Agarose gel electrophoresis of a) Laccase ORF sequence PCR product

b) M) λ-EcoT14 I digest marker, 2) pTF101.1-ubi plasmid digested by restriction endonucleases

c) Schematic structure of the recombinant pTF101.1-ubi-LAC construct

Agrobacterium transformation by pTF101-ubi-LAC vector

Agrobacterium tumefaciens strain EHA101 was transformed by the pTF101.1-ubi-LAC using the heat shock method.  Expression vector verification was done by PCR using bar gene primers and Laccase internal primers (Fig 4.12a and b).

Fig 16: Agarose gel electrophoresis of transformed A. tumefaciens cells

a) PCR detection of transformed A. tumefaciens using bar gene primers M: DL2000 marker; 1) pTF101.1-ubi-LAC; 2, 3, 4) PCR products of positive clones

b) PCR detection of transformed A. tumefaciens cells using Laccase gene specific primers M: DL2000 marker; 1) pTF101.1-ubi-LAC; 2, 3, 4) PCR products of positive clones

4.4 Discussion

Laccase gene family is conserved across several plant species.  These gene family members have been expressed during stress, cloned and characterized in various species such as Arabidopsis thaliana (Wang et al., 2014), maize (Caparro´s-Ruiz et al., 2006) and rice (Zhang et al., 2013).  Laccase is differentially expressed in various plant species under different stresses hence suggesting that it might play a role during plant stress tolerance and growth and development.  In this research, Zma-LAC was upregulated in drought, salt, alkali, cold stresses, ABA and Salicylic acid and K+ deficiency treatment thereby showing that it might be possible that the overexpression of Laccase would improve abiotic stress tolerance in maize.  Recently overexpression of Laccase has been done in several plant species but mainly focusing on growth and development phenotypic effects it poses.  In Arabidopsis thaliana, a rice gene (OsChl1) which encodes a putative precursor was overexpressed (Cho et al., 2014).  The Arabidopsis thaliana plants overexpressing the Laccase precursor showed an increased tolerance to drought and salinity stress.  Little is known about the effects of diverse abiotic stresses on lignin biosynthesis but the previous data raise possibilities that Laccase may potentially play a role in plant defense responses.

The conserved region was amplified and sequenced.  3’ and 5’ RACE PCR were used to amplify the 3’ end and 5’ end respectively.  The ORF finder tool was used to show the position of the coding sequence (CDS) and using designed primers it was amplified.  The CDS was 1749bp long and encoded for 583aa.  The sequence was aligned and analyzed by ClustalX.  Features of Laccases were observed during analysis of the Zm-LAC sequence.  The presence of four highly conserved ligands of copper, multi-copper oxidase signature, Proline-rich domain, putative N-glycosylation sites and a signal peptide sequence Fig 4.7.  Sequence homology analysis also showed that the Zma-LAC sequence was highly homologous to Ath-LAC17 (76%), Os-LAC13 (72%), Si-LAC (68%) and Ath-LAC11 (51%) (Table 4.1).  Evolutionary analysis was observed by the construction of a phylogenetic tree Fig4.8.  The tree showed that Zm-LAC (GRMZM2G072808) is evolutionary related to rice Laccase 13, Zm-LAC4 and Ath-LAC17.  This also suggests similar functions of the genes since they are evolutionary close. To further elucidate its function in plants, Zma-LAC was cloned and heterologously overexpressed in Nicotiana tabacum.

4.5 Summary

1. The conserved region of Zma-LAC was amplified and sequenced.  3’ and 5’ RACE PCR were used to amplify the 3’ end and 5’ end respectively.  The 1749bp Open Reading Frame (ORF) was amplified and sequenced.  Amino acid sequence analysis confirmed that it is a Laccase due to its features.
2. Two expression vectors harbouring the Zma-LAC ORF (pTF101.1-35s-LAC and pTF101.1-ubi-LAC) were constructed and transferred to Agrobacterium tumefaciens EHA101.

5. Molecular and physiological screening of the transgenic tobacco plants

Our expression pattern analysis data showed that the expression of Laccase is induced by various abiotic stresses whereas miR397a is repressed.  The Zma-miR397a binding site was also identified in the Zma-LAC sequence after Bioinformatic analysis. To further elucidate the functional analysis of Laccase in plants, transgenic tobacco plants overexpressing Laccase were generated.  This was also done to investigate whether the overexpression of Laccase could enhance stress tolerance in the model plant.

5.1 Materials and Experimental equipment

5.1.1 Plant materials

Wild type Tobacco (Nicotiana tabacum L. cv. 89) was grown under long day conditions (16-h light/8-h dark) under fluorescent lights at 22 °C.

5.1.2 Laboratory reagents

DNA Marker (Takara Co., Ltd. Dalian); Reverse transcription kit (Transgene Co., Ltd); DEPC water (Sangon Biological Engineering Co., Ltd); Plant genomic DNA extraction kit (Sangon Biological Engineering Co., Ltd); MS media (Sigma Co., Ltd).

5.1.3 Laboratory equipment

PCR thermocycler (TP600) (Takara Co., LTD. Dalian), NanoDrop2000c (Thermo Scientific Co., LTD. Shenyang gene), UV illumination Chamber (LRH – 70 – F) (Constant technology Co., LTD. Shanghai), Electronic Balance (PL303) (Mettler Toledo instrument Co., LTD. Shanghai), Spectrophotometer (Eppendorf Co. Ltd. Germany), High-speed refrigerated centrifuge (Medical analysis instrument factory. Shanghai), Shaking incubator (THZ – C) (Jiangsu Taicang experimental equipment factory), Dry Bath Instrument Co., LTD (Hangzhou), Gel imaging system (Phannaeia Biotech Image Master VDS).

5.2 Methodology

5.2.1 Tobacco transformation

Wild type Tobacco (Nicotiana tabacum L. cv. 89) was grown under long day conditions (16-h light/8-h dark) under fluorescent lights at 22 °C for 20d.

（1）Agrobacterium preparation

Agrobacterium tumefaciens harbouring the pTF101-35s-Zma-LAC is collected from the cryogenic freezer, thawed on ice and streak plated on YEP media supplemented with 100 mg/l Rifampicin + 50 mg/ Kanamycin + 100 mg/L Spectinomycin).  The plate is incubated in 28 ℃ conditions. After 36h, pick single bacterial colonies and transfer to 5 ml YEP liquid medium supplemented by above mentioned antibiotics.  Incubate this bacterial culture in 28 ℃ at 180 rpm for 20h on the shaker.  Transfer the bacterial solution to new YEP media without hormones at the ratio of 1:50 and incubate in 28℃ at 180rpm until the concentration reaches OD600 0.5 ~ 0.6.

(2) Preparation from tobacco leaves

Leaves from 20d old seedlings were used as plants for transformation.

(3) Agrobacterium-mediated transformation

Tobacco leaves are wounded using sterile tweezers and transferred to the above prepared bacterial solution. Mix thoroughly and let leaves suspend in bacterial solution for 10 minutes prior to blotting on a sterile filter paper.  Place the leaves upside down petri dishes containing MS medium supplemented by 6-BA 1mg/L+ NAA 0.1mg/L.  Incubate the leaves in the dark for 2-3 days at 28°C.

(4) Subculture to selective media

After co-cultivation, blot leaves on sterile filter paper and transfer leaves upside down to petri dishes containing MS medium supplemented by 1.5mg/l Biapholos and 500mg/l Cephalosporin. Incubate for 2 weeks in light.

(5) Subculture to rooting media

Wounded areas of leaves yield calli which gave rise to shoots.  A scalpel is used to cut 1-2cm of the shoots and subculture it on ½ MS media supplemented by 200µ/l NAA and 500mg/l cephalosporin.

5.2.2 Molecular screening of transgenic tobacco plants

(1) PCR detection

PCR is an important technique used for screening transgenic tobacco plants.

a. Genomic DNA extraction from tobacco leaves

Genomic DNA extraction is done following steps in 3.2.3

b. PCR screening of transgenic tobacco

Genomic DNA is used as a template. Zma-LAC-F and Zma-LAC-R primers are used to amplify the Zma-LAC gene and Zma-LAC-F and Nos-R primers are used to amplify part of the expression vector sequence.

The PCR reaction is as follows:

Genomic DNA（50ng/μl）	1μl
dNTP Mixture(2.5mM each)	2μl
10×PCR Buffer	2μl
Zma-LAC-F (10μM)	1μl
Zma-LAC-R(10μM)	1μl
EX Taq（5U/µl）	0.2μl
ddH2O	12.8μl
Total	20μl

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）
		35
72℃（10min）		1
16℃		∞

Genomic DNA（50ng/μl）	1μL
dNTP Mixture(2.5mM each)	2μL
10×PCR Buffer	2μL
Zma-LAC-F (10μM)	1μL
Nos-R(10μM)	1μL
EX Taq（5U/µL）	0.2μL
ddH2O	12.8μL
Total	20μL

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）
		35
72℃（10min）		1
16℃		∞

PCR amplification products were detected on 1% Agarose gel electrophoresis.

(2) Semi-quantitative RT-PCR

This screening method is an important measure of whether the target gene is expressed in tobacco.  Zma-LAC expressing plants will be further used in physiological analysis.

a. RNA extraction is done using the Trizol method as explained in 2.2.2.

b. 1st strand synthesis of cDNA is done using PrimerScriptTM RT reagent Kit with gDNA Eraser (Perfect Real-Time) following the manufacturer’s instructions on 2.2.2.  cDNA was used as a template to amplify the Zma-LAC gene in the following PCR reaction:

cDNA	1μl
dNTP Mixture(2.5mM each)	2μl
10×PCR Buffer	2μl
Zma-LAC-F (10μM)	1μl
Zma-LAC-R(10μM)	1μl
EX Taq（5U/µl）	0.2μl
ddH2O	12.8μl
Total	20μl

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）
		28
72℃（10min）		1
16℃		∞

PCR amplification products were detected on 1% Agarose gel electrophoresis.

The cDNA was used as a template to amplify the internal reference gene (Actin).  Actin-F and Actin-R primers were used for the amplification. The internal reference sequence is as follows:

Actin-F: 5′ -CTATTCTCCGCTTTGGACTTGGCA-3′

Actin-R: 5′ -AGGACCTCAGGACAACGGAAACG-3′

The PCR reaction is as follows:

cDNA	1μl
dNTP Mixture(2.5mM each)	2μl
10×PCR Buffer	2μl
Actin-F (10μM)	1μl
Actin-R(10μM)	1μL
EX Taq（5U/µl）	0.2μl
ddH2O	12.8μl
Total	20μl

PCR reaction conditions:

94℃（5min）		1
94℃（30s）   58℃（30s） 72℃（1min）
		28
72℃（10min）		1
16℃		∞

PCR amplification products were detected on 1% Agarose gel electrophoresis.

5.2.3 Transgenic Tobacco plants physiological analysis

Four-week transgenic tobacco plants were subjected to Salt stress and ABA treatment.  Salinity stress was initiated by sub-culturing wild-type and transgenic tobacco to ½ MS media supplemented by 150mM NaCl.  ABA treatment was initiated by sub-culturing wild-type and transgenic tobacco to ½ MS media supplemented by 3µM ABA.  For each treatment three replicates were used. After 14d, plants were photographed.

5.3 Results and analysis

5.3.1 Tobacco transformation

Agrobacterium tumefaciens EHA101 harboring the plant expression vector was used to transform wild type tobacco leaf discs.  Successful transformation led to callus formation and unsuccessful transformation led to cell and tissue death (yellowing of leaf discs).  Calli differentiated and developed to shoots in media supplemented with a selective marker (Bar) for three weeks.  When the shoots reached 1-2cm in length, they were subcultured to rooting medium.  After three weeks, transgenic plants were seen by rooting and maintaining the green colour of shoots in selective medium (Fig 5.1).

Fig 5.1. The transgenic tobacco plants after rooting media subculture

Positive transgenic tobacco lines developed roots and the leaves maintained a green colour after being subcultured in rooting media supplemented with a selective marker(Bar).

5.3.2 Molecular screening of transgenic plants

1) PCR screening of transgenic tobacco plants

For further screening of positive transgenic lines, genomic DNA was extracted from wild-type and transgenic lines (rooted seedlings).  DNA was run on a gel for purity and concentration analysis Fig 5.2.  Genomic DNA as a template, PCR detection of the transgenic lines was conducted using two pairs of primers (LAC-F and LAC-R; LAC-F and NOS-R).  Positive transgenic lines were seen by having a band 350bp and 796bp in length respectively after gel electrophoresis Fig 5.3 a and b.

Fig 5.2. The genomic DNA extraction of wild and transgenic tobacco plants

M) λ-EcoT14 I digest marker; wt) Wild type; 1-12) Transgenic tobacco plants

(a)

(b)

Fig 5.3   PCR detection of the Laccase gene in transgenic tobacco plants

1. M) DL2000 marker; ddH2O) water; P) Plasmid DNA; wt) Wild type; 1-12) Transgenic tobacco plants
2. M) DL2000 marker; ddH2O) water; P) Plasmid DNA; wt) Wild type; 1-12) Transgenic tobacco plants

2)Transgenic tobacco plants RT-PCR screening

RNA extraction

In order to further analyze the expression of the Laccase gene in different transgenic tobacco lines, semi-quantitative RT-PCR was used.  RNA of wild type and transgenic tobacco plant leaves was isolated using the Trizol method.  Agarose gel electrophoresis was used to detect the quality of RNA (Fig 5.4).

Fig 5.4. Wild type and transgenic tobacco plant leaves RNA gel electrophoresis

The agarose gel electrophoresis of tobacco leaf RNA M) DL2000 marker; wt) Wild type; 2,4-12) Transgenic tobacco plants

Semi-Quantitative RT-PCR

RNA was reverse transcribed to cDNA which was used as a template.  Laccase gene abundance in transgenic tobacco plants was detected using semi-quantitative RT-PCR.  Actin primers (Actin-F and Actin-R) were used to amplify the reference gene.  The results show that in eleven transgenic lines, four (3, 4, 7 and 8) showed high levels of expression as compared to the others (Fig 5.5).  The four highly expressed transgenic lines were used for the physiological experiments.

Fig 5.5. Semi-quantitative RT-PCR analysis of Laccase in transgenic tobacco lines

wt) Wild type; 1-11) Transgenic tobacco plants

5.3.3 Physiological analysis tobacco transgenic plants

(1) Phenotypic changes of transgenic tobacco under salt stress and ABA treatment

Root growth analysis under salt stress

Roots of transgenic and wild-type plants grown under salt stress for 14 days, showed differential growth.  The results suggested that root growth might be associated with plant tolerance to salt stress and ABA treatment.  The roots of transgenic plants were significantly longer as compared to wild-type.  The leaves of the wild type showed yellowing whereas the transgenic seedlings maintained a green colour showing that overexpression of Laccase in tobacco might have stress tolerance effects.

                             Wild type plants                                                           OXLAC transgenic plants

Fig 5.6. Phenotypic differences between wild type and transgenic tobacco plants under salt stress

a) Wild-type tobacco plants (leaves and roots) and b) Transgenic tobacco plants (leaves and roots)

                                  Wild type plants                                                         OXLAC transgenic plants

Fig 5.7. Phenotypic differences between wild-type and transgenic tobacco plants under ABA treatment

1. Wild-type tobacco plants (leaves and roots) and b) Transgenic tobacco plants (leaves and roots)

5.4 Discussion

Based on the results of transformation and stress assay, Laccase was successfully incorporated in the Nicotiana tabacum genome.  The presence of the gene was detected by PCR amplification of the gene sequence from DNA (Fig 5.3).  Expression analysis of Laccase in tobacco was observed using semi-quantitative RT-PCR.  The abundance of Laccase was increased to varying degrees in the transgenic OXLAC tobacco plants.  Amongst the eleven transgenic tobacco plants, four showed high expression as compared three which had relatively low expression and four had no expression at all (Fig 5.5).

As for the physiological analysis of the highly expressed OXLAC tobacco plants, two stress assays were investigated.  NaCl and ABA seemed to have a clear expression antagonism between miR397a and Laccase.  Salt stress is an osmotic stress which hampers plant growth and productivity hence the choice of the stress treatment.  The OXLAC transgenic plants were grown in MS media supplemented by NaCl and ABA.  After 14 days of growth, the results showed that roots did not grow under NaCl treatment in wild-type plants whereas they visibly grew in OXLAC transgenic plants.  In wild-type plants, yellowing of leaves was observed, but the leaves of the overexpressed plants remained green (Fig 5.6).  These results suggested that Laccase might be responsible for playing a role in root growth under salt stress in OXLAC tobacco plants.  Though the mechanism of response is unknown, it is assumed that Laccase was maybe responsible for rooting as a way of tolerance under salt stress.  A similar deduction was made after a rice Laccase precursor (OsChl1) was overexpressed in Arabidopsis thaliana and showed an increased tolerance to salt stress (Cho et al., 2014).

When OXLAC tobacco plants were grown in MS media supplemented by ABA, the wild-type plants showed minimal root growth as opposed to OXLAC plants which exhibited normal root growth (Fig 5.7).  All the plants were subjected to similar conditions but the leaves of the OXLAC tobacco plants were observed to be larger as compared to wild-type plants.  These results suggest a possible role of Laccase during growth and ABA treatment response.  Not much has been documented on the Laccase-mediated stress response but its suggested that it might play a role in alleviating stress.  With these results it can also be suggested that Laccase might play a role in root growth under stress.

5.5 Summary

1. The recombinant expression vector pTF101.1-35s-LAC was used to transform tobacco leaf-discs using the Agrobacterium-mediated method.  T0 transgenic plants were obtained.
2. Transgenic plants and wild-type plants were subjected to salt stress and ABA treatment for physiological analysis.  Transgenic tobacco plants showed normal root growth and development as compared to wild-type plants.

Conclusion

The recombinant plant expression vectors were constructed namely pTF101.1-ubi-pre-miR397a, pTF101.1-ubi-LAC and pTF101.1-35s-LAC.  Zma-LAC was overexpressed in tobacco so as to investigate the functional analysis.  The following conclusions were drawn during the cloning and characterization:

1. qRT-PCR results showed differential expression patterns for Zma-pre-miR397a and Zma-LAC in maize shoots and roots.  These results suggested that these two genes respond to various stresses and may play roles in abiotic stress response.  Zma-pre-miR397a and Zma-LAC were also differentially expressed in different maize tissues.  Their high expression in maize reproduction organs suggest that these two genes might be involved in maize reproduction.
2. Zma-pre-miR397a gene was cloned by PCR.  To ensure its protection and efficient processing, the 143bp pre-miR397a sequence was flanked by 226bp upstream and 288bp downstream.  The amplified sequence was run in NCBI BlastN against maize pre-miR397a from miRBase and the sequence identity was 100%.  pTF101.1-ubi-pre-miR397a recombinant expression vector was constructed.
3. Zma-LAC gene was cloned from maize.  The conserved region of the gene was amplified and 3’ and 5’ RACE PCR were used to amplify the 3’ end and 5’ end respectively.  The conserved region was 1062bp, 3’ end(709bp) and 5’end (926bp).  The ORF of Laccase was 1749bp and 583aa.  The coding sequence underwent through Bioinformatics analysis and it showed features of a typical Laccase.  Two recombinant expression vectors were constructed, pTF101.1-ubi-LAC (Z. mays) and pTF101.1-35s-LAC (Nicotiana tabacum).
4. Tobacco leaf discs were transformed by Zma-LAC using the Agrobacterium-mediated method.  The Laccase gene was incorporated in the tobacco genome.  PCR was used to screen for transgenic plants whereas semi-quantitative RT-PCR was used to observe the Laccase abundance in OXLAC tobacco plants before the physiological analysis.  OXLAC tobacco plants were grown on media containing NaCl and ABA and the transgenic plants showed a developed root system as opposed to wild-type plants.  This suggested Zma-LAC plays an important role in the root growth and development and improves salt stress and ABA tolerance.

References

1. Abdel-Ghany, S.E. and Pilon, M. (2008) MicroRNA-mediated systemic down-regulation of copper protein expression in response to low copper availability in Arabidopsis. J. Biol. Chem. 283, 15932–15945.
2. Barciszewska-Pacak, M., Milanowska, K., Knop, K., Bielewicz D, Nuc, P., Plewka, P., Pacak, A.M., Vazquez, F., Karlowski, W., Jarmolowski, A., Szweykowska-Kulinska, Z. (2015) Arabidopsis microRNA expression regulation in a wide range of abiotic stress responses. Front. Plant Sci. 6:410. doi: 10.3389/fpls.00410
3. Bartel, D.P. (2004) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell. 116, 281-297
4. Bartels, D. and Sunkar, R. (2005) Drought and Salt Tolerance in Plants. Critical Reviews in Plant Sciences, 24, 23-58.
5. Basel, K. Zhu, J.K., Zhu, J. (2011) Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochimica et Biophysica Acta 1819.137-148
6. Bej, S. and Basak, J. (2014) MicroRNAs: The Potential Biomarkers in Plant Stress Response. American Journal of Plant Sciences, 5, 748-759. http://dx.doi.org/10.4236/ajps.2014.55089
7. Berthet, S., Demont-Caulet, N., Pollet, B., Bidzinski, P., Cezard, L., Le Bris, P., Borrega, N., Herve, J., Blondet, E., Balzergue, S., Lapierre, C. and Jouanin, L. (2011) Disruption of LACCASE4 and 17 results in tissue-specific alterations to lignification of Arabidopsis thaliana stems. Plant Cell, 23, 1124–1137.
8. Bosch, M., Mayer, C.D., Cookson, A. and Donnison, I.S. (2011) Identification of Genes Involved in Cell Wall Biogenesis in Grasses by Differential Gene Expression Profiling of Elongating and Non-Elongating Maize Internodes. Journal of Experimental Botany, 62, 3545-3561.
9. Brodersen, P. and Voinnet, O. (2009) Revisiting the principles of microRNA target recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10, 141–148
10. Burkhead, J.L. et al. (2009) Copper homeostasis. New Phytol. 182, 799–816
11. Cai XN, Davis EJ, Ballif J, Liang MX, Bushman E, Haroldsen V, Torabinejad J, Wu YJ (2006) Mutant identification and characterization of the laccase gene family in Arabidopsis. J Exp Bot 57:2563−2569
12. Chen, C.J., Liu, Q., Zhang, Y.C., Qu, L.H., Chen, Y.Q. and Gautheret, D. (2011) Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus. RNA Biol. 8, 538–547
13. Dong, Y., Liu, W., Zhou, Y., Zhou, Y., Zhao, L., Yang S., (2013) LAC2 down-regulated by miR397a overexpression leads to hyper sensitisation and less tolerance to salt in Safflower. Plant Physiology.Q945
14. Dong, C.H. and Pei, H. (2014) Over-expression of miR397 Improves Plant Tolerance to Cold Stress in Arabidopsis thaliana. J. Plant Biol. (2014) 57:209-217
15. Eyles, R.P., Williams, P.H., Ohms, S.J., Weiller, G.F., Ogilvie, H.A., Djordjevic,M.A. and Imin, N. (2013) microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula. Planta, 238, 91–105.
16. Gavnholt, B., Larsen, K. & Rasmussen, S.K. (2002) Isolation and characterisation of laccase cDNAs from meristematic and stem tissues of ryegrass (Lolium perenne). Plant Science 162, 873–885.
17. Guleria, P., Mahajan, M., Bhardwaj, J. and Yadav, S. (2011) Plant Small RNAs: Biogenesis, Mode of Action and Their Roles in Abiotic Stresses. Genomics Proteomics Bioinformatics, 9, 183-199.
18. Han, R., Jian, C., Lv, J., Yan, Y., Chi, Q., Li, Z., Wang, Q., Zhang, J., Liu, X. and Zhao, H. (2014) Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.). BMC Genomics, 15,289.
19. Jeong, D.H.(2011) Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage. Plant Cell 23, 4185–4207
20. Jian, X., Zhang, L., Li, G., Zhang, L., Wang, X., Cao, X., Fang, X.H. and Chen, F. (2010) Identification of Novel Stress Regulated MicroRNAs from Oryza sativa L. Genomics, 95, 47-55.
21. Jones-Rhoades, M.W. and Bartel, D.P. (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol.Cell, 14, 787–799.
22. Jones-Rhoades, M.W., Bartel, D.P. and Bartel, B. (2006) MicroRNAs and Their Regulatory Roles in Plants. Annual Review of Plant Biology, 57, 19-53.
23. Khraiwesh, B., Arif, M.A., Seumel, G.I., Ossowski, S., Weigel, D., Reski, R. and Frank, W. (2010) Transcriptional Control of Gene Expression by MicroRNAs. Cell, 140, 111-122.
24. Khraiwesh, B., Zhu, J.K. and Zhu, J. (2012) Role of miRNAs and siRNAs in Biotic and Abiotic Stress Responses of Plants. Biochimica et Biophysica Acta, 1819, 137-148.
25. Kruszka, K., Pieczynskia, M., Windelsb, D., Bielewicza, D., Jarmolowskia, A., Kulinskaa, Z.S. and Vazquezb, F. (2012) Role of MicroRNAs and Other sRNAs of Plants in Their Changing Environments. Journal of Plant Physiology, 169, 1664-1672
26. Li, Y.-F., Zheng, Y., Addo-Quaye, C., Zhang, L., Saini, A., Jagadeeswaran.G, G., Axtell, M.J., Zhang, W. and Sunkar, R. (2010) Transcriptome-wide identification of microRNA targets in rice. Plant J. 62, 742–759.
27. Li, T., Li, H., Zhang, Y.X. and Liu, J.Y. (2011) Identification and analysis of seven H2O2-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica). Nucleic Acids Res. 39, 2821–2833.
28. Liu, P.P., Montgomery, T.A., Fahlgren, N., Kasschau, K.D. and Nonogaki, H. (2007) Repression of AUXIN RESPONSE FACTOR10 by MicroRNA160 Is Critical for Seed Germination and Postgermination Stages. Plant Journal, 52, 133-146
29. Liu, X. Tian, Y.-J. Li, C.-A. Wu, C.-C. Zheng, (2008) Microarray-based analysis of Stress-regulated microRNAs in Arabidopsis thaliana, RNA 14 836–843.
30. Lu, S.F., Sun, Y.H., Shi, R., Clark, C., Li, L.G. and Chiang, V.L. (2005) Novel and Mechanical Stress Responsive MicroRNAs in Populus trichocarpa that Are Absent from Arabidopsis. Plant Cell, 17, 2186-2203.
31. Lu, S., Sun, Y.H., Amerson, H. and Chiang, V.L. (2007) MicroRNAs in Loblolly Pine (Pinustaeda L.) and Their Association with Fusiform Rust Gall Development. The Plant Journal, 51, 1077-1098.
32. Lu, X.Y. and Huang, X.L. (2008) Plant miRNAs and Abiotic Stress Responses. Biochemical and Biophysical Research Communications, 368, 458-462
33. Lu, S., Quanzi, L., Hairong, W., Mao-Ju, C., Sermsawat, T.A., Hoon, K., Jie, L., Jingyuan, S.,Ying, S., Lichai, Y., Ting-Feng, Y., Ilona, P., John, R., Ronald, R. S., and Vincent, L.C. (2013) Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa 10848–10853 | PNAS | vol. 110 | no. 26
34. Luo, Y.C., Zhou, H., Li, Y., Chen, J.Y., Yang, J.H., Chen, Y.Q. and Qu, L.H. (2006) Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development. FEBS Lett. 580, 5111–5116.
35. Mangranthia, S.K., Surekha, A., Sailaja, B., Madhav, M., Voleti, S.R., (2013) MicroRNAs and Their Role is Salt Stress Response in plants. Salt Stress in Plant: Signalling, Omics and Adaptations
36. Mittler, R. (2002) Oxidative Stress Antioxidants and Stress Tolerance. Trends Plant Science, 7, 405-410.
37. Munns, M. and Tester, P. (2008) Mechanisms of salinity tolerance, Annu. Rev. Plant Biol. 59 651–681.
38. Nageshbabu, R., Jyoti, M.N., Sharadamma, N., Rai, D.V., Devaraj, V.R., (2013) Expression of miRNAs confers enhanced tolerance to drought and salt stress in Finger millet (Eleusine coracona). Journal of Stress Phys. And Biochem. Vol 9.No 3. 220-231
39. Novillo, F., Alonso, J.M., Ecker, J.R., Salinas, J. (2004) CBF2/DREB1C is a negative regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance in Arabidopsis. Proc Natl Acad Sci USA 101:3985−3990
40. Novillo, F., Medina, J., Rodríguez-Franco, M., Neuhaus, G., Salinas, J. (2012) Genetic analysis reveals a complex regulatory network modulating CBF gene expression and Arabidopsis response to abiotic stress. J Exp Bot 63:293−304
41. Novillo, F., Medina, J., Salinas, J., (2007) Arabidopsis CBF1 and CBF3 have a different function than CBF2 in cold acclimation and define different gene classes in the CBF regulon. Proc Natl Acad Sci USA 104:21002−21007
42. Pantaleo, G., Szittya, S., and Moxon, L. (2010) Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis, The Plant Journal, vol.62, no. 6, pp. 960–976
43. Peng, T., Sun, H., Qiao, M., Zhao, Y., Du, Y., Zhang, J., Li, J., Tang, G. and Zhao, Q. (2014) Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice. BMC Plant Biol. 14, 196.
44. Quinn, C.R., Iriyama, R. and Fernando, D.D. (2014) Expression patterns of conserved microRNAs in the male gametophyte of loblolly pine (Pinus taeda). Plant Reprod. 27, 69–78.
45. Ramachandran, V. and Chen, X. (2008) Small RNA metabolism in Arabidopsis. Trends Plant Sci. 13, 368–374
46. Ranocha, P., Chabannes, M., Chamayou, S., Danoun, S., Janeau, A., Boudet, A., Goffner D. (2002) Laccase Down-regulation Causes Alterations in Phenolic Metabolism and Cell Wall structure in Poplar. Plant Physiology Vol 129. 625-636
47. Shen, Y., Zhang, Z., Lin, H., Liu, H., Chen, J., Peng, H., Cao, M., Rong, T., Pan, G. (2010) Cytoplasmic male sterility-regulated novel microRNAs from maize. Functional and Integrative Genomics 11(1): 179-191
48. Sun, G., Stewart, C.N., Xiao, P., and Zhang, B. (2012). MicroRNA expression analysis in the cellulosic biofuel crop switchgrass (Panicum virgatum) under abiotic stress. PLoSONE 7:e32017. doi: 10.1371/journal.pone.0032017
49. Sunkar, R., Yong-Fang, L., and Guru, J. (2012）Functions of microRNAs in plant stress responses 196-203
50. Sunkar, R., and Zhu, J.K. (2004) Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16:2001−2019
51. Sunkar, R., Girke, T., Jain, P.K. and Zhu, J.K. (2005) Cloning and characterization of MicroRNAs from rice. Plant Cell, 17, 1397–1411.
52. Sunkar, R., Chinnusamy, V., Zhu, J. and Zhu, J.K. (2007) Small RNAs as Big Players in Plant Abiotic Stress Responses and Nutrient Deprivation. Trends in Plant Science, 12, 301-309.
53. Sunkar, R., Li, Y.F., Jagadeeswaran, G. (2012) Functions of microRNAs in plant stress responses. Cell Press.Vol 17.No 4. 197-203
54. Ting, J., and Qiao, S. (2015) The miRNA Libraries Analysis and verification of Maize Seedlings under Co-stress. Dalian University of Technology
55. Vidal, E.A. et al. (2010) Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana.Proc. Natl. Acad. Sci. U.S.A. 107, 4477–4482
56. Wang, L., Wang, M.B., Tu, J.X., Helliwell, C.A., Waterhouse, P.M., Dennis, E.S., Fu, T.D. and Fan, Y.L. (2007) Cloning and characterization of microRNAs from Brassica napus. FEBS Lett. 581, 3848–3856.
57. Wang, C.Y., Zhang, S., Yu, Y., Luo, Y.C., Liu, Q., Ju, C., Zhang, Y.C., Qu, L.H., Lucas, W.J., Wang, X. and Chen, Y.Q. (2014) MiR397b regulates both lignin content and seed number in Arabidopsis via modulating a laccase involved in lignin biosynthesis. Plant Biotechnol. J. 8, 1132–1142.
58. Xue, L.J., Zhang, J.J. and Xue, H.W. (2009) Characterization and expression profiles of miRNAs in rice seeds. Nucleic Acids Res. 37, 916–930.
59. Xu, Q., Liu, Y., Zhu, A., Wu, X., Ye, J., Yu, K., Guo, W. and Deng, X. (2010) Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type. BMC Genomics, 11, 246.
60. Yamasaki, H., Abdel-Ghany, S.E., Cohu, C.M., Kobayashi, Y., Shikanai, T. and Pilon, M. (2007) Regulation of Copper Homeostasis by Micro-RNA in Arabidopsis. Journal of Biological Chemistry, 282, 16369-16378.
61. Zhang, L., Chia, J.M., Kumari, S., Stein, J.C., Liu, Z., Narechania, A., Maher,C.A., Guill, K., McMullen, M.D. and Ware, D. (2009) A genome-wide characterization of microRNA genes in maize. PLoS Genet. 5, e1000716.
62. Zhang, L., Zheng, Y., Jagadeeswaran, G., Li, Y., Gowdu, K. and Sunkar, R. (2011) Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum. Genomics, 98, 460–468.
63. Zhang, Y.C., Yu, Y., Wang, C.Y., Li, Z.Y., Liu, Q., Xu, J., Liao, J.Y., Wang, X.J., Qu, L.H., Chen, F., Xin, P., Yan, C., Chu, J., Li, H.Q. and Chen, Y.Q. (2013) Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching. Nat. Biotechnol. 31, 848–852.
64. Zhao, B.T., Liang, R.Q., Ge, L.F., Li, W., Xiao, H.S., Lin, H., Ruan, K., Jin, Y., (2007) Identification of drought-induced microRNAs in rice. Biochem Biophys Res Commun 354:585−590
65. Zhao, R., Liang, L., Ge, W., Li, H., Xiao, H., Lin, K., and Ruan, Y. Jin. (2007) Identification of Drought-induced microRNAs in rice, Biochem. Biophys. Res. Commun. 354585–590.
66. Zhou, X., Wang, G., Sutoh, K., Zhu, J.K., Zhang, W. (2008) Identification of cold-inducible microRNAs in plants by transcriptome analysis. Biochim Biophys Acta 1779:780−788
67. Zhou, Y., Liu, Z., Liu, D., Kong, M., and Duan, L. (2010). Genome-wide identification and Analysis of drought-responsive microRNAs in Oryza sativa, J. Exp. Bot. 61 4157–4168
68. Zhou, Z.S., Song, J.B. and Yang, Z.M. (2012) Genome-wide identification of Brassica napus microRNAs and their targets in response to cadmium. J. Exp. Bot. 63, 4597–4613.
69. Zhu, Q.H., Spriggs, A., Matthew, L., Fan, L., Kennedy, G., Gubler, F. and Helliwell, C. (2008) A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains. Genome Res. 18, 1456–1465.

APPENDIX A

Abbr.	Full name
Zm	Zea Mays
PCR	Polymerase chain reaction
qPCR	Real-time Quantitative PCR
RT-PCR	Reverse transcription PCR
DNA	Deoxyribonucleic acid
cDNA	Complementary DNA
RACE	Rapid amplification of cDNA end
ROS   ABA SA	Reactive oxygen species   Abscisic acid Salicylic acid

APPENDIX B: Markers

APPENDIX C: Vectors

pMD18-T Vector

Plant expression vectors

Acknowledgements