Disclaimer: This dissertation has been written by a student and is not an example of our professional work, which you can see examples of here.

Any opinions, findings, conclusions, or recommendations expressed in this dissertation are those of the authors and do not necessarily reflect the views of UKDiss.com.

PCR and LAMP Assays for Detection of Phytophthora Infestans Spores

Info: 9461 words (38 pages) Dissertation
Published: 15th Jul 2021

Reference this

Tagged: Biomedical Science

Development of Real-Time PCR and LAMP Assays for the Detection of Sporangia of Phytophthora infestans and Spores of Alternaria solani to Inform Disease Risk Forecasting

Keywords: LAMP assays, rotating air samplers, Phytophthora infestans, Alternaria solani, IPM

Abstract

Diagnostic assays for the detection of sporangia of the causal pathogen of late blight, Phythophthora infestans, and spores of the main causal pathogen of early blight, Alternaria solani were developed to facilitate the in-field detection of air-borne inoculum in order to improve disease forecasting. The successful use of the assays in a field situation was demonstrated. Primers were designed for real-time loop-mediated isothermal amplification (LAMP) of P. infestans and A. solani. The specificity of the P. infestans LAMP assay was similar to that of an existing real-time PCR assay: DNA of P. infestans was consistently amplified as was DNA of the taxonomically closely related species P. mirabilis, P. phaseoli and P. ipomoea; no amplification of DNA from the potato pathogens P. erythroseptica or P. nicotianae occurred. A LAMP and a real-time PCR assay were developed for A. solani and the specificity compared to an existing conventional PCR assay. The A. solani LAMP and real-time PCR assays did not amplify the closely related species A. alternata. The sensitivity of all assays for the detection of DNA extracted from sporangia/spores of the target pathogens was evaluated. The LAMP assay for P. infestans detected 500 fg DNA (0.1 sporangium/reaction) with an incubation period of 40 minutes in 6 out of 8 replicates. In comparison, 20 fg DNA (0.004 sporangium/reaction) were detected with real-time PCR. In the case of A. solani, LAMP detected 4.4 pg DNA (1 spore/reaction) with an incubation period of 40 minutes. The sensitivity of the real-time PCR assay for A. solani was 200 fg DNA (0.04 spore/reaction). An in-field air sampler was deployed in a trial plot planted with potato and infected with P. infestans. Air samples were taken through the season and detection of air-borne inoculum of P. infestans with both real-time PCR and LAMP was assessed.

Introduction

Early and late blight of potato caused by various species of the fungal pathogen Alternaria spp. and the oomycete pathogen Phytophthora infestans respectively, can cause significant crop losses. Both are aerially transmitted and controlled by intensive fungicide programmes. Ideally these programmes can be tailored to control both pathogens in combination.

Early blight is considered to be predominantly caused by Alternaria solani Sorauer in Europe although A. alternata (Fries.) Keissler, which also causes brown spot, is also implicated. Symptoms are often initially observed on older, senescing leaves and are characteristically dark brown or black lesions with concentric rings on leaves, which produce a ‘target spot’ effect.

Early blight is widespread in most areas where potatoes or tomatoes are grown, but is especially prevalent in temperate zones and has recently occurred with increasing frequency in northern European potato growing areas (Edin 2012; Leiminger and Hausladen 2012; Runno-Paurson et al. 2015). In the UK, there has been increasing concern regarding the frequency and severity of early blight outbreaks. Reasons for this could include warmer prevailing temperatures favouring the pathogen, changes in fungicide use, or an increase in the area of susceptible varieties grown. It is known that host resistance to early blight exists and is heritable (Stewart et al. 1994; Odilbekov et al. 2014) however varietal resistance ratings for early blight in commercially grown varieties are not readily available.

Reported crop losses due to early blight in unsprayed fields vary enormously from 5 – 78% worldwide. Precise figures for total expenditure on fungicides for control of early blight are difficult to deduce due to the fact that it exists as just one of a complex of tomato/potato pathogens which are often controlled with the same products. Estimates suggest annual expenditure globally on fungicides for control of Alternaria spp. is around $32 million in tomatoes and $45 million in potatoes (Kemmitt 2002). According to Leiminger & Hausladen (2012), fungicides to control early blight are applied regardless of existing disease levels or disease-favourable weather conditions and this strategy may result in superfluous or ineffective fungicide applications. Managing the use of fungicides for the control of early blight is important as A. solani poses a high risk in terms of the development of fungicide resistance (Leiminger et al. 2014). For example, reduced sensitivity of A. solani to quinone outside inhibiting (QoI) fungicides has been reported in the USA (Pasche and Gudmestad 2008) and Europe (Leiminger et al. 2014; Edin and Andersson 2014) and resistance to the succinate dehydrogenase inhibitor (SDHI) fungicide boscalid has been reported in the USA (Wharton et al. 2012; Gudmestad et al. 2013). Inoculum of A. solani is primarily dispersed long-distance due to the prevailing weather and wind and can also originate from seed-borne infections, residual plant debris or other solanaceaous hosts (Rosenzweig et al. 2008). Decision support systems which forecast favourable weather for infection by Alternaria spp are used in some countries in order to manage early blight, but do not take into account the presence or absence of inoculum. Leiminger & Hausladen (2012) demonstrated that it is not necessary to apply early blight control throughout the season but that disease could be adequately controlled with only a few fungicide applications, using threshold values based on disease progress.

Late blight of potato, caused by Phytophthora infestans, is one of the most devastating diseases of potato world-wide and continues to be a major constraint to potato production in Europe and other key crops including tomato and other solanaceous plants worldwide. Economic losses to potato occur due to both control costs and crop losses: Haverkort et al. (2008)  estimate  that  15%  of the farm-gate  value of the potato crop is lost through late blight and, when translated to an EU scale,  this  could  represent  losses  in  the  region  of €900 million.

P. infestans inoculum may originate from seed-borne infections, volunteers, waste dumps and alternative hosts. Under optimal environmental conditions the pathogen can complete several infection cycles a week on a susceptible host, potentially producing very large quantities of sporangia. As a result of wind dispersal of the sporangia, and the potentially large number of generations, a late blight epidemic can quickly spread over large regions (Zwankhuizen and Zadoks 2002). The formation, release, and escape of spores from the canopy, the direction and extent of spore dispersal, the survival and deposition of spores, and the ability of spores to infect are determined by weather conditions (Skelsey et al. 2010).

Host resistance offers great potential for late blight control but the durability of resistance conferred by R genes is continually challenged due to the evolution of virulence traits within the pathogen population (Fry, 2008) and in NW Europe, varieties with greater resistance tend not to be grown on a large scale due to end-user preference for varieties with specific agronomic characteristics (Cooke et al. 2011). The relatively recent emergence of an aggressive lineage of P. infestans, able to overcome previously effective forms of plant host resistance and fungicides is discussed in some detail by Cooke et al. (2012).

Potato production is therefore dependent on the repeated use of fungicides throughout the growing season for the control of late blight. Choice of products within a spray programme and minimum intervals between applications are important considerations and there is pressure to reduce the use of fungicides and therefore their environmental and economic costs through increasing adoption of integrated pest management (IPM). The integrated control of potato late blight in Europe was previously reviewed by Cooke et al. (2011) who stressed the need for anti-resistance management of existing active ingredients, deployment of durable host resistance and the use of decision support systems (DSS) to improve timing of fungicide applications and allow fungicide use to be adjusted according to cultivar resistance and infection pressure.

The aerial dispersal of pathogen inoculum to uninfected hosts is crucial to the epidemic phase of many crop diseases (Skelsey et al. 2009; Skelsey & Newton, 2015). However, inoculum influx is largely ignored in risk assessments for crop diseases, in part due to the idiosyncrasies of the weather and the difficulty of knowing the locations of inoculum sources (Spitters et al. 1989). Instead, it is generally assumed that inoculum is ubiquitous and that the influx of inoculum will always occur at significant levels, so that future risk of disease is dependent only on local conditions for infection. Detection of air-borne inoculum in-field is therefore increasingly being recognised as a key factor missing from decision support systems (DSS) to inform early and late blight management strategies (Fall et al. 2015a).

Real-time PCR assays are both sensitive and specific in their ability to detect and quantify target DNA but they require thermocyclers and are better suited to laboratory use. Loop-Mediated Isothermal Amplification (LAMP) is a simple, rapid and specific nucleic acid amplification method. It is characterized by the use of 4 or 6 different primers specifically designed to recognize 6 distinct regions on the target gene and the reaction process proceeds at a constant temperature using strand displacement reaction (Notomi et al., 2000). Amplification and detection of target DNA can be completed in a single step by incubating at a constant temperature. Isothermal amplification techniques, including LAMP, have the advantage over real-time PCR techniques in that they do not require thermocyclers making them suitable for incorporation in to in-field detection devices.

Previously published methods of detecting A. solani and A. alternata by PCR include conventional PCR assays (Zur et al. 2002; Pavon et al. 2012), a conventional PCR assay combined with detection of the F129L substitution associated with loss of sensitivity to QoI fungicides in A.solani (Edin 2012) and real-time assays for the discrimination of SNPs related to loss of fungicide sensitivity in A. solani (Rosenzweig et al. 2008) and in planta quantification of A. solani and A. alternata (Leiminger et al 2015). Conventional PCR assays for the detection of P. infestans are also available (Judelson and Tooley, 2000; Hussain et al. 2005). Moreover, a number of real-time PCR assays for P. infestans have been developed (Böhm et al. 1999; Llorente et al. 2010; Lees et al. 2012 and Fall et al 2015b). Only the assays developed by Lees et al. (2012) and Fall et al. (2015b) were tested for both sensitivity and specificity and the two assays are comparable.

The objective of this work was to develop diagnostics suitable for in-field monitoring of P. infestans and A. solani inoculumand to demonstrate their ability to detect air-borne sporangia/spores with a view to incorporating inoculum detection into existing weather-based forecasting systems for early and late blight. The aim thereafter would be to improve predictions of disease risk and inform the initiation of spray programmes for disease control. There is scope to carry out further research to optimise the combined control of late blight and early blight in an integrated system.

Materials and Methods

Isolates and cultures

Twenty-eight isolates of Phytophthora species from various hosts including P. infestans isolates from potato and one isolate of Pythium ultimum (Table 1) were kindly supplied by David Cooke (The James Hutton Institute). Twenty-seven isolates of A. solani and A. alternata (Table 2) were used for assay development and comparison.

Extraction of DNA from mycelium and sporangia/spores

Isolates of Phytophthora species were grown on Rye A agar or Pea agar incubated at 18oC for 7 days and isolates of Alternaria on Potato Dextrose agar incubated at 20°C for 10 days. A 6mm2 plug was then taken from the edge of the colony and used to inoculate 20ml of Pea Broth (Phytophthora spp.) or Potato Dextrose Broth (Alternaria spp.) in a sterile 9 cm Petri dish. After 10 days incubation at 18oC or 20°C respectively the agar plug was removed and discarded and the resulting mycelium was washed in sterile distilled water and dried on a paper towel. A 0.1 g sample of mycelium was weighed and freeze-dried in a 1.5 mL Eppendorf tube overnight.

For sporangial production of P. infestans, leaves of potato cultivar Estima were inoculated with a sporangial suspension of an isolate of P. infestans and incubated in a damp chamber for 7 days at 15°C, after which the sporangia were washed off the leaves using sterile distilled water.

Spores of Alternaria species were produced by incubating cultures at 20oC in an incubator set at 16h light and 8h dark or under UV light (Philips Ltd 36W/80) with an alternating 12 hour photoperiod. Spores were removed using a glass rod by washing the plate with sterile distilled water.

The concentration of the sporangial/spore suspensions was measured using a haemocytometer and adjusted to 8000 spores/µl. Suspensions were then freeze-dried in 1.5 mL Eppendorf tubes. DNA was extracted from freeze dried mycelia and sporangia using a method modified from Raeder & Broda (1985): weight of starting material reduced to 30mg and volume of reagents increased by 1.5 times. DNA concentration (ng/µl) was quantified using a Nanodrop spectrophotometer ND-1000 (Thermo Fisher Scientific).

Alternaria solani and P. infestans real-time PCR assays

In order to develop a real-time PCR assay for A. solani, multiple sequence alignments of the ITS1 and ITS2 regions of A. solani and A. alternata were examined for regions potentially unique to A. solani. The primer express software version 3·0 (Applied Biosystems) was used to design a unique set of primers AsolF1 (5′-GGTGTTGGGCGTCTTTTTG -3′) and AsolR1 (5′-GCTAGACCTTGGGGCTGGA -3′) with an amplification product of 119 bp and a fluorogenic probe AsolP1 (5′-TCCCCTTGCGGGAGA-3′) based on regions of the greatest sequence dissimilarity among species after the alignment of ITS1 sequences, in order to develop a specific real-time quantitative PCR assay. The fluorogenic probe (AsolP1) was labelled at the 5′-end with the fluorescent reporter dye 6-FAM (6-carboxy-fluoroscein), while the 3′-end was modified with a black hole quencher (BHQ-1) (Eurofins Genomics). The starting concentration of target sequence present was calculated by comparing threshold cycle (Ct) values of unknown samples to the Ct values of standards with known amounts of A. solani DNA extracted from mycelium, where the Ct value is defined as the cycle number at which a statistically significant increase in the reporter fluorescence (i.e. exceeds the threshold) is first detected, and is dependent on the input of starting copies of target. Ct values were plotted against the log of the initial concentration of A. solani DNA to produce a standard curve.

The specificity of the A. solani qPCR assay was tested against 27 different isolates, 18 isolates of A. solani and 9 of the closely related species A. alternata (Table 2). Sensitivity of the assay was tested against dilutions of DNA extracted from spore suspensions of known concentration.

A previously described real-time assay for P. infestans (Lees et al., 2012) was used for comparison of the P. infestans assays.

Real-time PCR for P. infestans and A. solani

Real-time PCR amplification was carried out according to the methods described by Lees et al. (2012). Reaction components for quantitative real-time PCR were obtained from the Taqman® Universal PCR Mastermix (Applied Biosystems) and the reaction was performed in MicroAmp optical 96-well plates using the StepOnePlus Real–Time PCR System (Applied Biosystems). Primers PinfTQF/PinfTQR or AsolF1/AsolR1 were included at a final concentration of 0·3 μm per reaction, and the Taqman probe was used at 0·1μm in a total reaction volume of 25μL, shown previously to be optimal by primer and probe optimization tests. The recommended generic (three-stage) thermal cycle protocol was used for PCR amplification (Applied Biosystems) with an annealing temperature set at 60oc for A. solani and 61°C for the P. infestans assay for increased specificity. All quantities of target DNA were measured using a standard curve constructed by plotting critical Ct values versus the log of the initial concentration of pathogen DNA standards present. The Ct values for each PCR reaction were interpolated from the standard curves to calculate the amount of P. infestans/A. solani target DNA in a sample. Non-template controls were carried out in triplicate using 2 μL HPLC grade water instead of DNA during every run. All samples were tested in duplicate and results show the mean values generated.

LAMP assay primer design

LAMP primers were designed to detect P. infestans and A. solani based on the internal transcribed spacer sequence of a range of Phytophthora spp .and Alternaria isolates.  Sequences of the ITS region of P. infestans (obtained from GenBank) were compared with the potato infecting species P. erythroseptica and P. nicotiana to identify potential regions specific to P. infestans.  Similarly, ITS sequences from A. solani and A. alternata isolates were compared to identify regions able to discriminate these species. Primer design was carried out using LAMP Designer (Optigene, UK).  The six LAMP primers; external primers F3 and B3, internal primer FIP and BIP, and loop primers F-loop and B-loop shown in Table 3 were synthesised by Eurofins Genomics (Germany).

LAMP specificity and sensitivity

LAMP assays were carried out in a final reaction volume of 25 µl: 15 µl Isothermal Master Mix ISO-001 containing a ds-DNA binding dye (Optigene, UK), 5 µl primer mix consisting of external primers (F3 and B3) at 5µM, internal primers (FIP and BIP) at 20 µM, loop primers (F-loop and B-loop) at 10 µM final concentration and 5 µl DNA. Real-time LAMP was carried out using a StepOnePlus-System (Applied Biosystems). Reactions were incubated at 65oC for 40 minutes and the product visualised every 30 s using FAM detection channel.

The specificity of the LAMP PI1 primers was tested against genomic DNA (10ng/µl) of 28 different Phytophthora species and for LAMP Asol2 primers against 27 Alternaria isolates. LAMP assay sensitivity was tested against dilutions of DNA extracted from spore (Alternaria) or sporangial (P. infestans) suspensions of known concentration (0.1, 1, 10, 100, 1000, 10,000 A. solani spores/reaction; 0.01, 0.1, 1, 10, 100, 1000, 10,000 P. infestans sporangia/reaction). At least four replicate dilutions were tested. Non-template controls were tested in triplicate using 5 μl HPLC grade water in place of DNA during every run. All samples were tested in duplicate and results show the mean values generated.

Use of rotating air sampler for in-field detection of P. infestans spores

A control sample was used to measure the efficiency of detection of spores in the sampler to be used in the field; 4 replicate 100µl sporangial suspensions of P. infestans (containing 1, 5, 10, 20 and 100 sporangia) were added to 2ml screw cap tubes each containing 2 perspex arms coated with Vaseline®, as used in the rotating sampler. A water only control was also set up.  DNA was extracted from the samples using the MASTERPURE TM Yeast DNA purification kit (Epicentre (an Illumina company)). Phytophthora infestans in extracted DNA samples was then quantified using both LAMP and real-time PCR assays.

A field plot of potato cultivar Maris Piper (10 rows of 21 plants with 50cm spacing between plants) was planted on the 3rd May 2016 at a site at The James Hutton Institute (Dundee, UK). A rotating air sampler was placed in the centre of the trial on the 1st July. The air sampler was set to operate 2 minutes on, 2 minutes off for a 24h period at 3 to 4 day intervals until 18th August. Air samples were taken using rotating arm samplers which captured air-borne particles on sticky arms created by applying a thin smear of Vaseline® onto the leading edge of each of two rotating Perspex arms. The arms rotated clockwise at 2500 rpm, with air pulled in from below the rotating arms and thrown outwards through vents in a rain shield, therefore sweeping a new piece of air with each rotation.  They were powered by an electric motor operated from a 12-volt battery. On the 14th July 2016 five plants previously inoculated with P. infestans and showing foliar sporulatinglesionswere placed to either side of the air sampler at a distance of approximately 3m. The incidence of late blight on all plants within the plot was determined on each sampling occasion.

After each sampling period the two arms were removed from each trap and placed into a 2 ml screw-top tube.  DNA was extracted from the samples containing the arms as described previously.  P. infestans in extracted DNA samples was then quantified using both LAMP and real-time PCR assays.

Results

Specificity and sensitivity of real-time PCR assay for detection of A. solani

The specificity of primers JHIAsolF/JHIAsolR and a flurogenic probe JHIAsolP was tested against genomic DNA of 27 isolates of A. solani and A. alternata (Table 2). DNA amplification was observed in all 18 isolates of A. solani tested but not in the 9 isolates of A. alternata (Table 2). The real-time qPCR assay developed in this study reliably detected 200 fg template DNA per reaction, which was equivalent to 0.04 spores per reaction. The standard curve used to calculate the starting concentration of A. solani template DNA had a high correlation coefficient of R2 = 0.988 indicating a reproducible linear response in detection relating to increasing DNA concentration. The efficiency of the assay, calculated from the slope of the standard curve using the regression equation E=[(10(-1/slope))-1]x100 was over 95 %.

LAMP specificity and sensitivity for detection of A. solani

The specificity of the LAMP Asol2 primers was tested against genomic DNA of 27 different Alternaria isolates (Table 2). DNA amplification was consistently observed in A. solani isolates but not in isolates of the closely related species A. alternata (Table 2). Following incubation for 40 minutes at 65oC, detection of 1 spore/reaction (equivalent to 4.4 pg DNA) was reliably achieved (Figure 1).

LAMP specificity and sensitivity for detection of P. infestans

Specificity of the LAMP PI1 primers was tested against genomic DNA of 28 different Phytophthora species (Table 1). DNA amplification was consistently observed in P. infestans and also in isolates of the taxonomically closely related species P. mirabilis, P. phaseoli and P. ipomoea, which were also amplified by the real-time PCR assay of Lees et al. (2012) and the conventional primer set of Trout et al. (1997). Additionally, P. palmivora (a non-potato pathogen) amplified close to the threshold of detection after 34 mins. No amplification of DNA from the potato-infecting species (P. erythroseptica or P. nicotianae) occurred. The specificity results shown in Table 1 were obtained by running the LAMP assay for 40 mins at 65oC.

The P. infestans LAMP assay detected DNA 0.5 pg DNA (equivalent to 0.1 sporangium) in 6 out of 8 replicate dilutions. It detected 5 pg DNA (equivalent to 1 sporangium/reaction) reliably; i.e. this was the lowest concentration of DNA that could be detected in every replicate (Figure 2).

Detection of P. infestans spores on air sampling rods

Using real-time PCR, P. infestans DNA was reliably detected when as little as 1 sporangium was artificially added to a simulated air sample (Figure 3). The LAMP assay reliably detected P. infestans when 100 sporangia were added, but was less reliable at detecting P. infestans when spore numbers were lower, i.e. P. infestans was detected in 3/4, 2/4 and 2/4 replicates containing 20, 10 and 5 spores respectively using a 40 minute incubation period (Figure 3).

P. infestans sporangia (th July. The number of sporangia detected increased as disease incidence increased in the plot (Figure 4). LAMP detection was less sensitive than real-time PCR. When DNA equivalent to 87 sporangia per sample was detected using the real-time PCR it was also detected using the LAMP assay, consistent with the sensitivity determined in artificially inoculated samples.

Discussion

In this study, sensitive and specific LAMP assays capable of detecting 1 sporangium of P. infestans and 1 spore of A. solani were developed. This is the first published LAMP assay developed for A. solani that the authors are aware of. Two LAMP assays have recently been published for the detection of P. infestans in leaf tissue, but neither demonstrated detection of sporangia. Hansen et al. (2016) designed LAMP primers for P. infestans using the ITSII region which cross reacted with P. nicotianae. These authors went on to design more specific primers using the Rgn86_2 but found that they had much reduced sensitivity (200 pg DNA) even with an incubation period of 1 hour. They found no way to discriminate P. infestans from P. mirabilis, although they did manage to eliminate cross reactivity with P. ipomoea and P. phaseoli. Another recently developed LAMP assay for P. infestans (Ammour et al. 2017) has a similar specificity to the primers described here i.e. cross reaction with the non-potato pathogens P. mirabilis, P. ipomoea and P. phaseoli. The assay in this paper also cross reacted with the non-potato pathogen P. palmivora, which was not included in the specificity testing of the assays designed by either Hansen et al. (2016) or Ammour et al. (2017).Both the assay described in this paper and that of Ammour et al. (2017) target the ITSII region, although the primer sequences are different, and both have increased sensitivity compared to the assay of Hansen et al (2016).

Many existing Decision Support Systems (DSS) for disease control in a range of cropping systems assume the presence of inoculum during favourable environmental conditions. However, for a number of air-dispersed plant pathogens numerous factors can act on the seasonal timing of air-borne inoculum release and spread. Air sampling combined with target pathogen detection (laboratory based PCR techniques) has been deployed in a number of cropping systems as a means of assessing inoculum presence to inform disease control strategies (Gent et al., 2009; Fall et al., 2015b; Brachaczek et al. 2016; Cao et al., 2016; Kunjeti et al., 2016). Fall et al. (2015a) highlighted the need for detection of air-borne inoculum in DSS for P. infestans and developed a real-time PCR which detected sporangia (Fall et al., 2015b). This assay is comparable to that of Lees et al. (2012) with respect to specificity, and as demonstrated in this paper also with respect to detection of sporangia. Whilst real-time PCR techniques may provide the gold standard in terms of sensitivity for detection, the need for thermo-cycling makes the incorporation of real-time PCR methodology into the development of in-field detection devices problematic. However, combining the trapping of air-borne inoculum with isothermal detection assays such as LAMP integrated into in-field devices can be used as a way of alerting growers to disease risk periods and as an aid to control disease through the efficient use of fungicides. For example, Villari et al. (2017) demonstrated how the capture of air-borne inoculum of Magnaporthe oryzae, the causal pathogen of grey leaf spot of perennial ryegrass, in a spore trap in conjunction with pathogen detection using a LAMP assay could be used in disease risk forecasting. Thiessen et al. (2016) validated the effectiveness of spore trapping and detection of Erysiphe necator (causing grape powdery mildew) to determine presence of inoculum and thus initiate fungicide applications compared to a standard practice which was based on host development rather than inoculum presence. They found a reduction on average of 3.3 fungicide applications when applications were initiated using the inoculum detection system compared with standard practice without any increase in disease symptoms.

Current weather-based disease risk models and predictions for late blight and early blight could potentially be enhanced through early in-field detection of P. infestans and Alternaria spp., leading to better decision making ability for growers with respect to fungicide choice and application and therefore more efficient resource use. In this paper, LAMP assays for the detection of air-borne spores of P. infestans and A. solani were developed and an ability to capture sporangia of P. infestans in the field and detect them using the LAMP assay was demonstrated, suggesting that it is suitable for incorporation into automated in-field detection devices designed for this purpose. In combination with recently improved weather-based disease risk forecasts for late blight such as the Hutton criteria (Dancey et al, 2017 in press), infection risk models which provide a framework for quantifying the impact of future climates on the risk of disease occurrence and spread (Skelsey et al. 2016) and the development of a simple and robust tool for forecasting the risk of between-field spread of disease based on the viability of dispersing inoculum (Skelsey et al. 2018) this new diagnostic tool may contribute to improvements in  the accuracy of disease risk warning systems for late blight, or indeed any crop pathosystem which is characterised by air-borne inoculum.

Literature cited

Ammour, M. S., Bilodeau, G.J., Tremblay, D.M., Van der Heyden, H., Yaseen, T., Varvaro, L. and Carisse, O. 2017. Development of real-time isothermal amplification assays for on-site detection of Phytophthora infestans in potato leaves. Plant Disease 101: 1269-1277.

Böhm, J., Hahn, A., Schubert, R., Bahnweg, G., Adler, N., Nechwatal, J., Oehlmann, R., and Obszwald, W. 1999. Real-time Quantitative PCR: DNA Determination in Isolated Spores of the Mycorrhizal Fungus Glomus mosseae and Monitoring of Phytophthora infestans and Phytophthora citricola in their Respective Host Plants. Journal of Phytopathology 147: 409–416.

Brachaczek, A., Kaczmarek, J., and Jedryczka, M. 2016. Monitoring blackleg (Leptosphaeria spp.) ascospore release timing and quantity enables optimal fungicide application to improved oilseed rape yield and seed quality. European Journal of Plant Pathology 145: 643-657.

Cao, X., Yao, D., Zhou, Y., West, J.S., Xu, X., Luo, Y., Ding, K., Fan, J., and Duan, X., 2016. Detection and quantification of airborne inoculum of Blumeria graminis f. sp. tritici using quantitative PCR. European Journal of Plant Pathology 146: 225-229.

Cooke, L.R., Schepers, H.T.A.M., Hermansen, A., Bain, R.A., Bradshaw, N.J., Ritchie, F.,  Shaw, D.S.A., Evenhuis, Kessel, G.J.T., Wander, J.G.N., Andersson, B., Hansen, J.G., Hannukkala, A., Nærstad, R., and Nielsen B.J. 2011. Epidemiology and Integrated Control of Potato Late Blight in Europe. Potato Research 54: 183-222.

Cooke, D.E.L., Cano, L.M., Raffaele, S., Bain, R.A., Cooke, L.R., Etherington, G.J., Deahl, K.L., Farrer, R.A., Gilroy, E.M., Goss, E.M., Grünwald, N.J., Hein, I., MacLean, D., McNicol, J.W., Randall, E., Oliva, R.F., Pel, M.A., Shaw, D.S., Squires, J.N., Taylor, M.C., Vleeshouwers, V.G.A.A., Birch, P.R.J., Lees, A.K., and Kamoun, S. 2012. Genome analyses of an aggressive and invasive lineage of the Irish potato famine pathogen. PLoS Pathogens 8(10) e1002940.

Dancey, S.R., Skelsey, P.,and Cooke, D.E.L. 2017 in press. The Hutton Criteria: a classification tool for identifying high risk periods for potato late blight disease development in Great Britain. Proceedings of the 16th EuroBlight Workshop. PPO Special Report no.18. ISSN 1569 – 321X.

Edin, E. 2012. Species specific primers for identification of Alternaria solani, in combination with analysis of the F129L substitution associated with loss of sensitivity toward strobilurins. Crop Protection 38, 72-73.

Edin, E., and Andersson, B. 2014. The early blight in Sweden – species abundance and strobilurin sensitivity. In: Schepers HTAM, editor. Proceedings of the Fourteenth EuroBlight Workshop 2013, 12–15 May; PPO Special Report No. 16. Limassol; p. 83–84.

Fall, M.L., Van der Heyden, H., Brodeur, L., Leclerc, Y., Moreau, G. and Carisse, O., 2015. Spatiotemporal variation in airborne sporangia of Phytophthora infestans: characterization and initiatives towards improving potato late blight risk estimation. Plant Pathology, 64: 178–190.

Fall, M.L., Tremblay, D.M., Gobeil-Richard, M., Couillard, J., Rocheleau, H., Van der Heyden, H., Lévesque, C.A., Beaulieu, C., and Carisse O. 2015. Infection Efficiency of Four Phytophthora infestans Clonal Lineages and DNA-Based Quantification of Sporangia. PLOS ONE 10(8): e0136312.

Fry, W. 2008. Phytophthora infestans: the plant (and R gene) destroyer. Molecular Plant Pathology 9: 385–402.

Gent, D.H., Nelson, M.E., Farnsworth, J.L. and Grove, G.G. 2009. PCR detection of Pseudoperonospora humuli in air samples from hop yards. Plant Pathology 58, 1081-1091.

Gudmestad, N.C., Arabiat, S., Miller, J.S., and Pasche, J.S. 2013. Prevalence and Impact of SDHI Fungicide Resistance in Alternaria solani. Plant Disease 97, 952-960.

Hansen, Z.R., Knaus, B.J., Tabima, J.F., Press, C.M., Judelson, H.S., Grünwald, N.J. and Smart, C.D. 2016. Loop-Mediated Isothermal Ampfication (LAMP) for detection of the tomato and potato late blight pathogen, Phytophthora infestans. Journal of Applied Microbiology 120(4): 1010-1020.

Haverkort, A. J., Boonekamp, P. M., Hutten, R., Jacobsen, E., Lotz, L. A. P., Kessel, G. J. T., Visser, R. G. F., and  van der Vossen, E. A. G. 2008. Societal Costs of Late Blight in Potato and Prospects of Durable Resistance Through Cisgenic Modification. Potato Research 51: 47-57.

Hussain, S., Lees, A. K., Duncan, J. M. and Cooke, D. E. L. 2005. Development of a species-specific and sensitive detection assay for Phytophthora infestans and its application for monitoring of inoculum in tubers and soil. Plant Pathology, 54: 373–382.

Judelson, H. S. and Tooley, P. W. 2000. Enhanced Polymerase Chain Reaction Methods for Detecting and Quantifying Phytophthora infestans in Plants. Phytopathology 90:10, 1112-1119

Kemmitt, G. 2002. Early blight of potato and tomato. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-01 Updated 2013.

Kunjeti, S. G., Anchieta, A., Martin, F.N., Young-Joon Choi, Thines, M., Michelmore, R.W., Koike, S.T., Tsuchida, C., Mahaffee, W., Subbarao, K.V. and Klosterman, S.J. 2016. Detection and Quantification of Bremia lactucae by Spore Trapping and Quantitative PCR. Phytopathology 106:11, 1426-1437.

Lees, A. K., Sullivan, L., Lynott, J. S. and Cullen, D. W. 2012. Development of a quantitative real-time PCR assay for Phytophthora infestans and its applicability to leaf, tuber and soil samples. Plant Pathology, 61: 867–876.

Leiminger, J.H.,and Hausladen, H. 2012. Early blight control in potato using disease-orientated threshold values. Plant Disease 96, 124–30.

Leiminger, J.H., Adolf, B., and Hausladen, H. 2014. Occurrence of the F129L mutation in Alternaria solani populations on Germany in response to QoI application, and its effect on sensitivity. Plant Pathology 63, 640-650.

Leiminger, J.H., Bäßler, E., Knappe, C., Bahnweg, G., and Hausladen, H. 2015. Quantification of disease progression of Alternaria spp. on potato using real-time PCR. European Journal of Plant Pathology 141(2): 295-309.

Llorente, B., Bravo-Almonacid, F., Cvitanich, C., Orlowska, E., Torres, H.N., Flawiá, M.M. and Alonso, G.D. 2010. A quantitative real-time PCR method for in planta monitoring of Phytophthora infestans growth. Letters in Applied Microbiology, 51: 603–610.

Odilbekov, F., Carlson-Nilsson, Liljeroth E. 2014. Phenotyping early blight resistance in potato cultivars and breeding clones. Euphytica 197, 87-97.

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Research. 28:e63.

Pasche, J. S., and Gudmestad, N.C. 2008. Prevalence, competitive fitness and impact of the F129L mutation in Alternaria solani from the United States. Crop Protection 27, 427-435.

Pavón, M. Á., González, I., Martín, R., and García, T. 2012. A real-time reverse-transcriptase PCR technique for detection and quantification of viable Alternaria spp. in foodstuffs. Food Control 28, 286–294.

Rosenzweig, N., Olaya, G., Atallah, Z.K., Cleere, S., Stanger, C., and Stevenson, W.R. 2008. Monitoring and tracking changes in sensitivity to azoxystrobin fungicide in Alternaria solani in Wisconsin. Plant Disease 92, 556–60.

Runno-Paurson, E., Loit, K., Hansen, M., Tein, B., Williams, I.H., and Mand, M. 2015. Early blight destroys potato foliage in the northern Baltic region. Acta Agriculturae Scandinavica, Section B — Soil & Plant Science 65, 422-432.

Skelsey, P., Rossing, W. A. H., Kessel, G. J. T., and van der Werf, W. 2009. Scenario Approach for Assessing the Utility of Dispersal Information in Decision Support for Aerially Spread Plant Pathogens, Applied to Phytophthora infestans. Phytopathology 99(7): 887-895.

Skelsey, P., Rossing, W.A.H., Kessel, G.J.T., and van der Werf, W. 2010. Invasion of Phytophthora infestans at the Landscape Level: How Do Spatial Scale and Weather Modulate the Consequences of Spatial Heterogeneity in Host Resistance? Phytopathology 100: 1146-1161.

Skelsey, P. and Newton, A. C. 2015. Future environmental and geographic risks of Fusarium head blight of wheat in Scotland. European Journal of Plant Pathology 142(1): 133-147.

Skelsey, P., Cooke, D. E. L., Lynott, J. S. and Lees, A. K. 2016. Crop connectivity under climate change: future environmental and geographic risks of potato late blight in Scotland. Global Change Biology, 22: 3724–3738.

Skelsey, P., Dancey, S. R., Preedy, K., Lees, A.K., Cooke, D.E.L. 2018. Forecasting the spread of aerially transmitted crop diseases with a binary classifier for inoculum survival. Plant Pathology DOI: 10.1111/ppa.12808

Spitters, C. J. T., van Keulen, H., and van Kraalingen, D.W.G. 1989. A simple and universal crop growth simulator: SUCROS87. Pages 147-181 in: Simulation and Systems Management in Crop Protection. R.Rabbinge, S. A. Ward, and H. H. van Laar, eds. Pudoc, Wageningen, The Netherlands.

Stewart, H.E., Bradshaw, J.E., Wastie, R.L., Mackay, G.R., Erlich O., Livescu, L., and Nachmias A. 1994. Assessing progenies of potato for resistance to early blight. Potato Research 37: 257

Thiessen, L.D., Keune, .J.A, Neill, T.M., Turechek, W.W., Grove, G.G. and Mahaffee, W.F. 2016. Development of a grower-conducted inoculum detection assay for management of grape powdery mildew. Plant Pathology 65:238-249.

Villari, C., Mahaffee, W.F., Mitchell, T.K., Pedley, K.F., Pieck, M.L. and Hand, F.P. 2017. Early detection of airborne inoculum of Magnaporthe oryzae in turfgrass fields using a quantitative LAMP assay. Plant Disease 101: 170-177.

Wharton, P., Fairchild, K., Belcher, A., and Wood, E. 2012.  First Report of In-Vitro Boscalid-Resistant Isolates of Alternaria solani Causing Early Blight of Potato in Idaho. Plant Disease 96, 454-454.

Zur, G., Shimoni, E. M., Hallerman, E., & Kashi, Y. 2002. Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay. Journal of Food Protection, 65, 1433–1440.

Zwankhuizen, M. J. and Zadoks, J. C. 2002. Phytophthora infestans´s 10-year truce with Holland: a long-term analysis of potato late-blight epidemics in the Netherlands. Plant Pathology 51, 413-423.

Species (Hutton isolate codea) Host Country of origin Amplification detected
      real-time PCR LAMP (40 minutes)
Phytophthora infestans (2009_7454A) 6_A1 Potato UK + +
Phytophthora infestans (2009_7654A) 13_A2 Potato UK + +
Phytophthora  alni  (SCRP161) Alder UK – –
Phytophthora cambivora (SCRP692) Raspberry UK – –
Phytophthora citophthora (SCRP1883) Unknown China – –
Phytophthora cryptogea (SCRP205?) Potato Ireland – –
Phytophthora drechsleri (SCRP2321) Beet USA – –
Phytophthora erythroseptica (SCRP 11704) Unknown Unknown – –
Phytophthora fragariae (SCRP2452) Strawberry UK – –
Phytophthora fragariae var. rubi  (SCRP3332) Raspberry UK – –
Phytophthora gonapodyides (SCRP11632) Unknown UK – –
Phytophthora idaei (SCRP3702) Raspberry UK – –
Phytophthora ilicis (SCRP3771) Holly UK – –
Phytophthora insolita (SCRP3853) Unknown Taiwan – –
Phytophthora inundata(SCRP9515) Olive Spain – –
Phytophthora ipomoea (SCRP11684) Morning Glory Mexico + +
Phytophthora castaneae (SCRP3886) Unknown Unknown – –
Phytophthora kernoviae (SCRP9571) Beech UK – –
Phytophthora lateralis (SCRP3903) Lawson Cypress USA – –
Phytophthora megasperma (SCRP4172) Raspberry UK – –
Phytophthora mirabilis(SCRP11674) Four o’clock flower Mexico + +
Phytophthora nicotianae (SCRP11607) Tobacco China – –
Phytophthora palmivora (SCRP4741) Coconut Ivory Coast – +
Phytophthora phaseoli  (DNA) Bean Unknown + +
Phytophthora plurivora (SCRP383?) Syringa Unknown Not tested –
Phytophthora quercina (SCRP5408) White oak Germany – –
Phytophthora ramorum (SCRP9541) Viburnum UK – –
Phytophthora pseudosyringae (SCRP7349) Beech Italy – –
Pythium ultimum (SCRP12003) Potato UK Not tested –

Table 1.  Isolate details and detection (+/-) of isolates of Phytophthora species used for specificity testing of LAMP assay compared to existing real-time PCR assay (Lees et al. 2012). aIsolates were supplied by 1Clive Brasier, Forest Research, UK; 2The James Hutton Institute, UK; 3CABI Bioscience, Egham, UK; 4Wageningen University, Netherlands; 5Jozsef Bakonyi, Plant Protection Institute, Hungarian Academy of Sciences;  6Frank Panabiere, INRA, France; 7Weixing Shan, Northwest A&F University, China; 8Bavarian State Institute of Forestry, Germany; 9Santina Cacciola, University of Catania, Italy.

Species (isolate code a) Country of Origin PCR assay

 

A. sol

PCR assay

 

A. alt

Real-time

 

A. sol

LAMP

 

A. sol

Alternaria solani  (A.s Pol1 1) Poland + – + +
Alternaria solani (A.s 12) Sweden + – + +
Alternaria solani (A.s 13-13) USA + – + +
Alternaria solani (A.s 526-33) USA + – + +
Alternaria solani  (A.s 1178-W13) USA + – + +
Alternaria solani (A.s 1178-E13) USA + – + +
Alternaria solani (A.s 1172-63) USA + – + +
Alternaria solani (A.s 1179-133) USA + – + +
Alternaria solani (A.s 1174-93) USA + – + +
Alternaria solani (A.s 1246-153) USA + – + +
Alternaria solani (A.s 1185-73) USA + – + +
Alternaria solani (A.s 1214) Germany + – + +
Alternaria solani (A.s 3 1615) Israel + – + +
Alternaria solani (A.s 3 1115) Israel + – + +
Alternaria solani (FM286) UK + – + +
Alternaria solani (FVLl16) UK + – + +
Alternaria solani (J156) UK + – + +
Alternaria solani (J86) UK + – + +
Alternaria alternata (A.a 27) USA – + – –
Alternaria alternata (A.a 37) USA – + – –
Alternaria alternata (A.a Pol21) Poland – + – –
Alternaria alternata (A.a 3e2) Sweden – + – –
Alternaria alternata (A.a 42) Sweden – + – –
Alternaria alternata (A.a 1354) Germany – + – –
Alternaria alternata (A.a 2104) Germany – + – –
Alternaria alternata (A.a 2994) Germany – + – –
Alternaria alternata (1308) UK – + – –

Table 2. Isolate details and detection (+/-) of isolates of Alternaria solani (A.sol) and Alternaria alternata (A. alt)used for specificity testing of LAMP assay and real-time PCR assay compared to existing conventional PCR assays (Zur. 2002). All isolates originate from potato. a 1Józefa Kapsa, IHAR, Poland ; 2, Eva Edin, Swedish University of Agricultural Sciences, Sweden ; 3 Neil Gudmestad, North Dakota State University, USA; 4 Gerd Stammler, BASF, Gemrnay; 5Leah Tsror, Gilat Research Centre, Israel; 6Jane Thomas, NIAB, Cambridge, UK ;  7Willie Kirk, Michigan State University, USA;  8Science & Advice for Scottish Agriculture (SASA), Edinburgh, UK.

Primer sets

 

 

Sequence (5’-3’) Length (bp)
     
P. infestans

 

PI1 primers

   
F3_PI1 TGAACCGTTTCAACCCAAT 19
B3_PI1 TTCGCAGCGTTCTTCATC 18
FIP(F1c+F2)_PI1 AAGCTACTAGCTCAGACCGAAGTCTTTATTGCTGGCGGCTA 41
BIP(B1c+B2)_PI1 CTGATTATACTGTGGGGACGAAAGTCATGTGCGAGCCTAGACAT 44
LoopF_PI1 CAAACGCTCGCCTTTTGAT 19
LoopB_PI1 TAACTAGATAGCAACTTTCAGCAGT 25
A. solani    
Asol2 primers    
F3_Asol2 CTTGTTTCCTTGGTGGGCT 19
B3_ Asol2 AATGACTTTAAGGCGAGTCTC 21
FIP(F1c+F2)_ Asol2 GCTGCGTTCTTCTGCCAGACAATCAGCGTCAGTAACAATG 40
BIP(B1c+B2)_ Asol2 ATCATCGAATCTTTGAACGCACATTGTTGAGGGTACAAATGACGC 45
LoopF_ Asol2 ACCAAGAGATCCGTTGTTGAA 21
LoopB_ Asol2 CTTTGGTATTCCAAAGGGCATG 22
     

Table 3. LAMP primers for detection of P. infestans and A. solani.

Cite This Work

To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Related Services

View all

Related Content

All Tags

Content relating to: "Biomedical Science"

Biomedical Science focuses on how cells, organs and systems function in the human body and underpins much of modern medicine. Biomedical Science applies parts of natural and/or formal sciences to help develop advances in healthcare.

Related Articles

DMCA / Removal Request

If you are the original writer of this dissertation and no longer wish to have your work published on the UKDiss.com website then please: